The PokéCommunity Forums

The PokéCommunity Forums (https://www.pokecommunity.com/index.php)
-   Tabletop Games (https://www.pokecommunity.com/forumdisplay.php?f=28)
-   -   You make the Card! (https://www.pokecommunity.com/showthread.php?t=21754)

Akio123 November 3rd, 2007 11:51 AM

Fixed it, as you can see I specified where it is added too.

Forci Stikane November 3rd, 2007 12:03 PM

Better, but......it's still seriously outclassed by:

Quote:

Originally Posted by Ichaste Pekoni (Post 3043729)
Let me get this straight...
Normal Spell

Special Summon 1 "A GIANT ROCK!!!!" from your hand, Deck, or Graveyard.

:\ Special Summoning >>>>>> adding to hand...usually.

Akio123 November 3rd, 2007 12:42 PM

True, but use mine first then use "Let me get this straight."

Time for some more Gadgets! XD

Advanced Gadget: Blue Gadget
Machine-Earth
Monster effect
1200/1400 4 stars

Add 1 "Advanced Gadget: Pink Gadget" to your hand from your deck or graveyard.

Advanced Gadget: Pink Gadget
Machine-Earth
Monster Effect
1100/1200 4 stars

Add 1 "Advanced Gadget: Black Gadget" to your hand from your deck or graveyard.

Advanced Gadget: Black Gadget
Earth-Machine-Monster-Effect
1300/1400
Add 1 "Advanced Gadget: Blue Gadget" to your hand from your deck or graveyard.

Rainbow Lord Gadget
7 stars-Earth-Machine
????/????
This monster can not be normal summoned or set. This monster can only be special summoned by tributing any number of monsters with "Gadget" in it's name. This monster's attack and defense is the combined attack and defense of every monster tributed. At the end phase of the turn this card was summoned, remove all monsters in the graveyard with "Gadget" Or "Advanced Gadget" in their name from play. In addition the following effects can be activated based on which of these monsters are tributed:
-Red Gadget:All spell cards are negated
-Yellow Gadget: All trap cards are negated
-Green Gadget: All monsters with an attack lower then this monster are destroyed.

Edit: I wanted to make Rainbow Lord Gadget a wee bit less broken, but it still is. XD

Forci Stikane November 3rd, 2007 1:23 PM

Quote:

Originally Posted by Akio123 (Post 3044837)
True, but use mine first then use "Let me get this straight."

Mine Special Summons it from anywhere you're getting it from with your card plus the hand, so no.

Time for some more Gadgets! XD

Advanced Gadget: Blue Gadget
Machine-Earth
Monster effect
1200/1400 4 stars

Add 1 "Advanced Gadget: Pink Gadget" to your hand from your deck or graveyard.

Graveyard recursion makes Gadgets even MORE dangerous than they already were.

Advanced Gadget: Pink Gadget
Machine-Earth
Monster Effect
1500/1600 4 stars

Add 1 "Advanced Gadget: Black Gadget" to your hand from your deck or graveyard.

See above. The stats are also overkill for a Gadget.

Advanced Gadget: Black Gadget
Earth-Machine-Monster-Effect
1300/1400
Add 1 "Advanced Gadget: Blue Gadget" to your hand from your deck or graveyard.

Once again, see above.

Rainbow Lord Gadget
7 stars-Earth-Machine
????/????
This monster can not be normal summoned or set. This monster can only be special summoned by tributing any number of monsters with "Gadget" or "Advanced Gadget" in it's name. This monster's attack is determined by how many monsters tributed to special summon this card.At the end phase of the turn this card was summoned, remove all monsters with "Gadget" Or "Advanced Gadget" in their name from play. On addition the following effects can be activated based on which of these monsters are tributed:
-Red Gadget:All spell cards are negated
-Yellow Gadget: All trap cards are negated
-Green Gadget: All monsters with an attack lower then this monster are destroyed.

Edit: I wanted to make Rainbow Lord Gadget a wee bit less broken, but it still is. XD

Actually, Rainbow Lord Gadget is completely unusable. For one thing, you don't say exactly how much ATK it gets for each tribute (500? 5000? 50? What?) and there's no mention of its DEF. Also, do you remove all monsters EVERYWHERE from play or what? You need to be a LOT more specific with your card effects. Oh, and just saying "Monsters with 'Gadget' in their card name" covers Advanced Gadgets as well. There's no need to mention both.

Scarlet Weather November 3rd, 2007 1:37 PM

Not to mention that RLG removes itself from play with its current wording. XD

Moving on...

"They're Cute Birds That You Ride"
Quickplay Spell
Special summon one "Wandering Bokocho" from your hand or deck.

Wandering Bokocho
Monster/Wind/Winged Beast/Effect/4*
Atk 100/ Def 1200
While this monster and another "Wandering" monster are face-up on your side of the field, your opponent may not target this card for an attack.

Moving on.... (Ahem)

Sinspawn
Quickplay Spell
Discard one card from your hand. Special summon three "Dark Fiend" tokens to your side of the field. (Monster/Dark/Fiend/Effect/2*, Atk 0000/Def 0000). These tokens may only be offered for a tribute summon if all three are offered for the same monster.

Also known as "Yubel's peons". XD

Yubel Alius
Monster/Dark/Fiend/Gemini/6*
Atk 0000/Def 0000
This monster is treated as a normal monster while in your hand and in the graveyard. When this face-up monster is on the field, you may normal summon it. If so, it becomes an effect monster with the following effect(s):
-This monster cannot be destroyed by battle. Battle damage received from battles involving this monster is inflicted on your opponent instead. If this monster is destroyed as a result of a card effect controlled by your opponent, special summon one "Yubel Das Whatever that other random German word is Ritter" from your hand or deck, ignoring summoning restrictions.

And to reference the third season GX ending (sort of...)

Elemental Hero Yubel
Monster/Dark/Warrior/Effect/6*
Atk 0000/ Def 0000
This monster is not destroyed as a result of battle. Battle damage given to the controller of this card from battles involving this card is given to the opponent instead.

Akio123 November 3rd, 2007 7:04 PM

Quote:

Originally Posted by Ichaste Pekoni (Post 3044968)
Actually, Rainbow Lord Gadget is completely unusable. For one thing, you don't say exactly how much ATK it gets for each tribute (500? 5000? 50? What?) and there's no mention of its DEF. Also, do you remove all monsters EVERYWHERE from play or what? You need to be a LOT more specific with your card effects. Oh, and just saying "Monsters with 'Gadget' in their card name" covers Advanced Gadgets as well. There's no need to mention both.

Yeah, I was trying to make it a Garzett. I should have said the combined attack of all gadgets used to special summon it.

Alter Ego November 4th, 2007 1:54 AM

Quote:

Originally Posted by ACC-M (Post 3045019)
special summon one "Yubel Das Whatever that other random German word is Ritter" from your hand or deck, ignoring summoning restrictions.

"Abscheulich". That's faulty grammar, though. Ritter is a masculine noun so that should be "Der abscheuliche Ritter", I believe. Literal translation: "Yubel the horrible knight".[/Language geek]

Aaaanyways...

"They're Cute Birds That You Ride": 'kay...how about a shorter name? Effect is sort of very limited; sort of like a Flute of Summoning Kuriboh.

Wandering Bokocho: And this monster is useful for...what, precisely? Besides being cute and getting sacrificed for vampire, I mean. Since you can ride them, shouldn't this be a union monster that gives some nifty boost to wanderers? :3

Sinspawn: I'm pretty sure that Yubel was two tributes, at least in the anime. (Specifically, Yubel played Pain Rose or whatever that card was called to convert 2000 points of damage into two tokens and sacrificed them) Also, Yubel really has greater problems with staying in play since it requires you to sacrifice a monster on each end phase. O=

Yubel Alius: Couldn't you just have copy-pasted the real gemini wording? "This card is treated as a Normal Monster while face-up on the field or in the Graveyard. While this card is face-up on the field, you can Normal Summon it to have it treated as an Effect Monster with this effect:".

Elemental Hero Yubel: "All Battle Damage from battles involving this card is inflicted to your opponent". Erm...pretty freakin' annoying for a one-tribute, not to mention that both Tomato and Warrior Lady can pull this one out. Never really thought of Yubel as a hero type (since he/she/it is basically just obsessing over Judai all the time), but w/e.


The giant rock cards are just too cool for me to rate and Icha already covered the rest, so...


Elusive Phantom
Fiend/Effect
3 Star/Dark
1000 Atk / 1000 Def

Once per turn, when your opponent summons or sets a monster in the same column as this card, you may move this card to another unoccupied monster card zone on your Field. This card can only be attacked by and is only affected by the effects of cards in the same column as this card. If your opponent doesn't control a monster in the same column as this card, this card can attack your opponent directly.

Blast Trooper
Pyro/Effect
4 Star/Fire
1500 Atk / 800 Def

When all zones of this card's column are occupied, destroy all cards in this card's column. When all zones of this card's row are occupied, destroy all cards in this card's row. When all zones of both this card's row and this card's column are occupied at the same time, destroy all cards in this card's row AND this card's column. For each card destroyed by this card's effect, inflict 500 damage to the controller of the destroyed card(s).

Linear Seal
Continuous Spell

Negate the effects and attacks of all other cards in the same column as this card.

Golden Vein
Normal Spell

Activate only when all other card zones in this card's row are occupied. Both players draw four cards then show the cards they drew to each other. Neither player can play the cards drawn by this effect on the turn this effect is activated.


Yeah, I know senet sucks but it's the only card type I haven't given any love to yet. x3 Now moving on from that:

Heart of Greed
Continuous Trap

Whenever you receive at least 1000 damage as the result of an attack declared by your opponent, draw a card for every 1000 points of damage you receive. You may only activate the effect of one "Heart of Greed" at a time.

Scarlet Weather November 4th, 2007 6:27 AM

@Cute Birds: The name is the explanation I gave when Mom asked me what a Chocobo was. (I was attempting to master Cinco de Chocobo on the piano at the time.) XD

@Wandering Bokocho: Whoops. That was meant to read "Your opponent cannot target 'Wandering' monsters with his attacks. Basically, Wandering Bokocho opens up Wandering Stall possibilities. Inspired by the fact that random encounters do not occur while riding chocobo. XD

@Sinspawn: OCG Yubel does require three tributes, and Judai uses three tributes for it when summoning it as a small child in the anime. Besides, this is also a neat card to throw in for Wicked God players, should such people exist. XD

@E-Hero Yubel: This one was a bit of a nomi on my part. I actually like E-Heroes and Neo-Spacians, though I despise their inability to compete with other competitive decks. E-Hero Big City is totally going to become my deck once I get WC07.

Heart of Greed: So basically, let the opponent attack me directly in order to attain massive CA? Actually, I'd rather this be a normal trap, because I'm sure that with the ability to stay on the field somebody's got to be abusing it. >.<

Golden Vein: It's Card of Sanctity's illegitimate offspring! Me like, except that with the current wording your opponent gets to drop his new hand before you do, since his turn is obviously not the turn that Golden Vein was played on.

Linear Seal: Meh. Senat effects just stink in general, but this one's pretty fair.

Elusive Phantom: ZOMG ANOTHER PLAYABLE SENAT. THE WORLD IS ENDING.

Blast Trooper: No. Row, I'm assuming, means that if I have more then four monsters out at once, I get my field nuked, and I'm trading that for what? A monster-type Blasting Fuse with burn? No thank you.

Wandering Blitzer
Monster/Water/Warrior/Effect/4*
Atk 1500/ Def 1400
When your opponent declares an attack on this monster, reveal the top card of your deck and activate the appropriate effect:
-Spell: During your opponent's next turn, they may not activate spell cards targeting specific monsters on the field.
-Trap: Your opponent cannot activate trap cards during your next battle phase.
-Monster: Flip a coin and call it. If you win the toss, negate the attack of your opponent's monster.

Wakka becomes an annoying as heck monster. Basically, those three abilities are as close as I could come to representing his ability to inflict, silence, sleep, and darkness. (All insanely useful.) Should I up him to one-tribute, do you think, or keep him this low?

Forci Stikane November 4th, 2007 9:45 AM

Quote:

Originally Posted by Alter Ego (Post 3047246)
The giant rock cards are just too cool for me to rate and Icha already covered the rest, so...

COP-OUT! Rate my GIANT ROCK cards anyway!!

Elusive Phantom
Fiend/Effect
3 Star/Dark
1000 Atk / 1000 Def

Once per turn, when your opponent summons or sets a monster in the same column as this card, you may move this card to another unoccupied monster card zone on your Field. This card can only be attacked by and is only affected by the effects of cards in the same column as this card. If your opponent doesn't control a monster in the same column as this card, this card can attack your opponent directly.

Senet?? It's actually pretty useful, believe it or not...and definitely troublesome. I can certainly see you getting 3 or 4 Direct Attacks out of this card.

Blast Trooper
Pyro/Effect
4 Star/Fire
1500 Atk / 800 Def

When all zones of this card's column are occupied, destroy all cards in this card's column. When all zones of this card's row are occupied, destroy all cards in this card's row. When all zones of both this card's row and this card's column are occupied at the same time, destroy all cards in this card's row AND this card's column. For each card destroyed by this card's effect, inflict 500 damage to the controller of the destroyed card(s).

...I see no usefulness for this card. It destroys all your monsters (unless you do a Creature Swap or something, but that's so situational that it isn't worth it), AND hits you for 1000 minimum.

Linear Seal
Continuous Spell

Negate the effects and attacks of all other cards in the same column as this card.

......Now *this* I can see getting used. Ojama lock gains a whole new meaning.

Golden Vein
Normal Spell

Activate only when all other card zones in this card's row are occupied. Both players draw four cards then show the cards they drew to each other. Neither player can play the cards drawn by this effect on the turn this effect is activated.

Set 4 Spells, then activate. Bam, instant refill.

Yeah, I know senet sucks but it's the only card type I haven't given any love to yet. x3 Now moving on from that:

Heart of Greed
Continuous Trap

Whenever you receive at least 1000 damage as the result of an attack declared by your opponent, draw a card for every 1000 points of damage you receive. You may only activate the effect of one "Heart of Greed" at a time.

Um...what about the remainder? Otherwise, I can see it getting comboed with cards like Solemn Wishes (this + 2 Solemn Wishes = insane), but not much else...

Quote:

Originally Posted by ACC-M (Post 3047715)
Wandering Blitzer
Monster/Water/Warrior/Effect/4*
Atk 1500/ Def 1400
When your opponent declares an attack on this monster, reveal the top card of your deck and activate the appropriate effect:
-Spell: During your opponent's next turn, they may not activate spell cards targeting specific monsters on the field.
-Trap: Your opponent cannot activate trap cards during your next battle phase.
-Monster: Flip a coin and call it. If you win the toss, negate the attack of your opponent's monster.

Wakka becomes an annoying as heck monster. Basically, those three abilities are as close as I could come to representing his ability to inflict, silence, sleep, and darkness. (All insanely useful.) Should I up him to one-tribute, do you think, or keep him this low?

Wakka shouldn't have that effect. Seriously. How about bypassing monsters as a tribute to Blitzball? ......Nah, that wouldn't work either. I just know that a monster that is Grizzly-searchable shouldn't have an effect like that.

Alter Ego November 4th, 2007 10:36 AM

Quote:

Originally Posted by Ichaste Pekoni (Post 3048233)
...I see no usefulness for this card. It destroys all your monsters (unless you do a Creature Swap or something, but that's so situational that it isn't worth it), AND hits you for 1000 minimum.

Situational? Riiight...because zombie and samurai obviously don't go about dropping down two to three monsters per round. O= This also works with stuff like Ojama Trio and Ground Collapse since it only requires the zones to be occupied; it doesn't bother with the why of it. If you swap it to your opponent then it's he/she who'll be taking the 1000 minimum; and be looking at an empty field to boot. There's Scapegoat too. Without Creature Swap or Mystic Box it's not worth the trouble in any situation, I'll give you that; just wanted to make a monster with a silly little effect, that's all. xD

Quote:

Originally Posted by Ichaste Pekoni (Post 3048233)
Set 4 Spells, then activate. Bam, instant refill.

That's why that last provision is there. Your opponent gets as many cards as you do, but they also get to play them first as a counter-balance. And ACC: the reason I put it there is because dedicated burn decks already get a pretty crazy boost from this; don't want to initiate a new line of FTKOs. O=

Quote:

Originally Posted by Ichaste Pekoni (Post 3048233)
Um...what about the remainder? Otherwise, I can see it getting comboed with cards like Solemn Wishes (this + 2 Solemn Wishes = insane), but not much else...

The remainder does nothing whatsoever. So even if you take...say, 1900 damage from one attack and 2100 from another, your sum of draws would still be three. I figured it had plenty of umph to it even that way. (This + Living Fire ftw! xD *Shot*) And ACC: I considered making it a Normal Trap, but then you'd have to take a direct hit from Cyber Dragon just to outperform Jar of Greed. O= Oh, and this card would play well with Damage Condensor too, I think. ;3

As for the phantom: yay, I got a 'troublesome''! ^0^ You see, I came up with this card when I was thinking about what kind of card effect would best emulate the fighting style of Larxene from KH; and Larxene is all about troublesome, lunging back and forth across the screen all the time with her stupid move speed increase card. >.<


Wandering Blitzer: that's "if you call it right" on the coin toss effect, but yeah; raise his Atk by a few hundred and make him a 5-star imo.


Aaand since Icha insists:

Let me get this straight...: fair enough, because this means that I can get out star player out without resorting to Giant Rat. It's just too bad that we can't trick the opponent into attacking it like it was set...unless we've rigged the backrow with Book of Moon. :3

Shut up, I'm busy.: hell yeah, "A GIANT ROCK!!!!" stall-burn is born. ^0^

But what does this mean????: Adding some of that burn aspect to the mix. The rock is such a teaser. ;P

Best. Rock. Evar.: this + Canyon + some way of making opponents attack "A GIANT ROCK" while it's face-up = OTKO. Hmm...A Hero's Last Stand, anyone? xD

History is about to repeat itself.: and the rocks just keep coming; which only goes to show that when it comes to defense, you can't beat giant rocks. Too bad the specific supports don't work with "ANOTHER GIANT ROCK!!!!".

Ancient Egyptian Spoiler Tags: So...does this bypass summoning restrictions too? Because if it does then the opponent will be hard-pressed to guess whether that's a game winning spell or an uberly powerful nomi of doom that's lurking face down. Oh, and what about traps? I mean, does not having been set count as not meeting activation requirements? O=


There, Icha; I rated. Happy now? >O

Anyways:


Runic Knight
Warrior/Effect
4 Star/Dark
1800 Atk / 1600 Def

If a Spell Card is activated while this card is face-up on the Field, negate the activation and effect of that card and destroy it, then tribute this card.


Now where did I come up with the idea for that one, I wonder? xD

Forci Stikane November 4th, 2007 11:29 AM

Quote:

Originally Posted by Alter Ego (Post 3048350)
Aaand since Icha insists:

Let me get this straight...: fair enough, because this means that I can get out star player out without resorting to Giant Rat. It's just too bad that we can't trick the opponent into attacking it like it was set...unless we've rigged the backrow with Book of Moon. :3

XD

Shut up, I'm busy.: hell yeah, "A GIANT ROCK!!!!" stall-burn is born. ^0^

But what does this mean????: Adding some of that burn aspect to the mix. The rock is such a teaser. ;P

Best. Rock. Evar.: this + Canyon + some way of making opponents attack "A GIANT ROCK" while it's face-up = OTKO. Hmm...A Hero's Last Stand, anyone? xD

History is about to repeat itself.: and the rocks just keep coming; which only goes to show that when it comes to defense, you can't beat giant rocks. Too bad the specific supports don't work with "ANOTHER GIANT ROCK!!!!".

Ancient Egyptian Spoiler Tags: So...does this bypass summoning restrictions too? Because if it does then the opponent will be hard-pressed to guess whether that's a game winning spell or an uberly powerful nomi of doom that's lurking face down. Oh, and what about traps? I mean, does not having been set count as not meeting activation requirements? O=

Hmm......that would depend. I say treat it in the same ruling as Premature Burial (I.E., if the card says "This card can only be Special Summoned by", it'll work, but if it says "This card cannot be Special Summoned except by", then no). This also brings Rituals into the mix *hinthint*...

Yeah, you can play them directly from your hand, just like with Makyura. Note the card's Quick-play-ness, as well, which means Spells can be played from your hand like that too.


There, Icha; I rated. Happy now? >O

Yes.

Anyways:


Runic Knight
Warrior/Effect
4 Star/Dark
1800 Atk / 1600 Def

If a Spell Card is activated while this card is face-up on the Field, negate the activation and effect of that card and destroy it, then tribute this card.


Now where did I come up with the idea for that one, I wonder? xD

Hum, paranoia certainly comes to mind with that last card. I'm guessing it was inspired by Skull Descalibur? Well, regardless, it's quick negation, and could certainly mess up somebody's tempo. ...Now let's see the Trap version.

However, before we get to that:

IT'S GIANT!!!!!!!!!
Continuous Spell
Increase the ATK and DEF of all "A GIANT ROCK!!!!" and "ANOTHER GIANT ROCK!!!!" on your side of the field by 1000. During each of your opponent's Battle Phases, if there is a face-up monster on your side of the field with "GIANT ROCK!!!!" in its card name, he/she must attack it with all Attack Position monsters on his/her side of the field (if multiple monsters exist, your opponent selects which one to attack). Tribute 1 EARTH-type monster on your side of the field during each of your Standby Phases. If you do not, this card is destroyed.

Scarlet Weather November 5th, 2007 2:28 PM

It's GIANT!!!!!: The new OTK deck: Rock of Giantness. XD

Overdrive Power
Continuous Spell
While this card and a "Wandering" monster are on your side of the field, you may add one "Limit Break" spell card to your hand when you take battle damage. During your standby phase, reduce your life points by half. If you do not, this card is destroyed.

Phoenix Down
Normal Spell
Select and activate one of the following effects:
-Special summon one "Wandering" monster from your graveyard. Monsters summoned through this effect are destroyed during the end phase of the turn they were summoned.
-Add one "Wandering" monster from your graveyard to your hand.

Lancet
Quickplay Spell
If your opponent activates a monster effect targeting a "Wandering" monster on your side of the field, pay one thousand life points in order to negate that effect. The targeted monster's effect becomes the negated effect until the end phase of your next turn.

Whaddya think? Too cheap?

Alter Ego November 6th, 2007 5:22 AM

IT'S GIANT!!!!!!!!!: Like, I dunno'...this name isn't really emphasizing that it's a giant rock we're dealing with. ;D Anyways, yeah, the giant rock can now officially OTKO. xD

Overdrive Power: underpowered if anything. Slicing your own life points is a brutal maintenance cost if I ever saw one. x.O

Phoenix Down: Yeah, a bit too cheap. How about giving it a two-pronged effect? Either summon a monster and have it destroyed at the end phase or put it in your hand, no questions asked. It would still be a higher-utility Wanderer version of The Warrior Returning Alive. :3

Lancet: so let me see if I got this straight...negate your opponent's Exiled/D.D/whatever and then toss the effect back at them next turn? I dunno' since the usable effect pool is sort of limited. I mean, we basically have Exiled, Snipe Hunter and the occasional D.D. monster. but...what else? Monarch effects won't work because they only triggers on summon, so unless we're going to extreme lengths just so we can play with Snipe Hunter (Who'll probably just toss another card and blast the copycat) then we're pretty much limited to Enishi. If you want Exiled's effect you'd probably be better off playing the dang thing itself rather than copying it. Besides, we're losing the wanderer's own effect for that turn too. O= Hmm...does Sasuke Samurai #4 target? I'm having serious trouble finding anything that you could (and would want to) respond to with this. x.O

And yeah, Skull was the basis for Runic Knight. (Surprise O=) An identical one for traps would be a bit too repetitive, though, so I have...something else in mind. xD

Anyways:

Restless
Zombie/Effect
4 Star/Dark
1750 Atk / 0 Def

You may send this card in your Hand to the Graveyard to add one "Restless" from your Deck to your Hand. You may only activate the effect of one "Restless" each turn.

Saboteur Fiend
Fiend/Effect
4 Star/Dark
1800 Atk / 1300 Def

If a Trap Card is activated while this card is face-up on the Field, the player who activated the card flips a coin and calls it. If the player called it wrong, negate the activation and effect of the card and destroy it.

Relentless Crossout
Normal Spell

Both players declare the name of a monster card, then both players send all cards with either of the declared names from their Decks to their Graveyards.

Warp Reality
Normal Spell

This card can only be activated when both players have at least one face-down monster on the Field. Rearrange all face-down monsters on the Field, then your opponent selects a number of the face-down cards equal to the number of face-down monsters he/she had on the Field. Control of all monsters your opponent selected is switched to him/her and control of all other face-down monsters is switched to you.

Frostweaver November 6th, 2007 10:05 AM

Restless- fair enough, more self-milling for exodia (we always need some of that) and zombies can fill up their graveyard even faster, but not like they needed help or lack of better things to do for deck space, like dust tornado.

Saboteur Fiend- we now have a soft lock for traps because after we worked so hard to finally boost the usage of traps up a bit, we have to condemn it again. Sasuke Samurai 4 for traps. Good thing we don't have a fairy box of it too.

Relentless Crossout- foolish burial upgraded on most part. Using it your opponent probably don't know what to call except the usual staples, but you know exactly what to dump for your favor (I call Elemental Hero Neos and dump all 3 in my graveyard in one card X3). On the other hand if it's a match and 2nd round though, it works for both sides a lot better then. Fun card.

Warp Reality- More Creature Swap, just a bit more specified.



Forget the rocks. On with the Gods.

Slifer the Executive Producer
Dragon/Effect
12 Star/Divine
? Atk / ? Def

This card cannot be normal summoned or set. This card can only be special summoned from your hand if you used at least 20 dollars in Yu-Gi-Oh products and merchandises today. The Atk and Def of this card is equal to 50 x each dollar you spent on Yu-Gi-Oh products and merchandises, rounded up to the nearest dollar. If this card is destroyed or removed from play by a card your opponent controls, increase the costs of all Yu-Gi-Oh Trading Card Game booster packs for your opponent by 50% until the rating of the anime "Yu-Gi-Oh GX" increases.

Forci Stikane November 6th, 2007 10:14 AM

Quote:

Originally Posted by Alter Ego (Post 3054117)
IT'S GIANT!!!!!!!!!: Like, I dunno'...this name isn't really emphasizing that it's a giant rock we're dealing with. ;D Anyways, yeah, the giant rock can now officially OTKO. xD

As long as you can get your opponent to go through their Battle Phase, that is. They can always skip it and make your costs go up.

Restless
Zombie/Effect
4 Star/Dark
1750 Atk / 0 Def

You may send this card in your Hand to the Graveyard to add one "Restless" from your Deck to your Hand. You may only activate the effect of one "Restless" each turn.

Um......recursion bait? But we have so many BETTER options for that...

Saboteur Fiend
Fiend/Effect
4 Star/Dark
1800 Atk / 1300 Def

If a Trap Card is activated while this card is face-up on the Field, the player who activated the card flips a coin and calls it. If the player called it wrong, negate the activation and effect of the card and destroy it.

Good enough. Certainly better than a self-destruct effect.

Relentless Crossout
Normal Spell

Both players declare the name of a monster card, then both players send all cards with either of the declared names from their Decks to their Graveyards.

"I call Black Luster Soldier - Envoy of the Beginning! Now let's see that deck!!"

Heheh, I can see trouble stirring here...


Warp Reality
Normal Spell

This card can only be activated when both players have at least one face-down monster on the Field. Rearrange all face-down monsters on the Field, then your opponent selects a number of the face-down cards equal to the number of face-down monsters he/she had on the Field. Control of all monsters your opponent selected is switched to him/her and control of all other face-down monsters is switched to you.

Um, so you're randomly trading monsters? Eh, the wording needs a bit of work, I think.

Quote:

Originally Posted by Frostweaver (Post 3054605)
Forget the rocks. On with the Gods.

Slifer the Executive Producer
Dragon/Effect
12 Star/Divine
? Atk / ? Def

This card cannot be normal summoned or set. This card can only be special summoned if you used at least 20 dollars in Yu-Gi-Oh products and merchandises today. The Atk and Def of this card is equal to 50 x each dollar you spent on Yu-Gi-Oh products and merchandises, rounded up to the nearest dollar. If this card is destroyed or removed from play by a card your opponent controls, increase the costs of all Yu-Gi-Oh Trading Card Game booster packs for your opponent by 50% until the rating of the anime "Yu-Gi-Oh GX" increases.

XD Alright, then.

Mega Ultra Chicken
Winged Beast/Effect
12 Stars/Divine
? ATK/? DEF
When this card is Normal Summoned, you must cluck. If you do not, this card is destroyed. This card gains 100 ATK for each chicken your opponent has eaten in his/her life. If this card is Special Summoned, you may revive the ghosts of all chickens your opponent has eaten and have them haunt him/her.

XD

Scarlet Weather November 6th, 2007 2:32 PM

Obelisk the Tormentor
Monster/God/Divine Beast/Effect/12*
Atk 4000/Def 4000
By sacrificing one "Mega Ultra Chicken" and one "Slifer the Executive Producer" on your side of the field, you can either give this monster infinite attack points or give your opponent an epileptic seizure. By yelling "TORMENT!!!!" really, really loudly, you may cause your opponent to defy logic and attack you anyway. If you are an anime character voiced by Dan Green, you may screw the rules without money.

Speaking of which...

Money
Normal Spell
Screw the rules.

Need I say more?

And just because I can't hold this back any longer...

Kaiba's Ego
Monster/Dark/Dragon/Effect/1000*
Atk ????/Def ???
This monster's combined attack and defense is equal to how highly you think of yourself on a scale from one to ten x1000. If you are playing this monster in a duel simulator, destroy that simulator. You may only summon this monster if you have used the effect of "Money" to screw the rules.

Alright, finished. XD

Forci Stikane November 6th, 2007 3:15 PM

Quote:

Originally Posted by ACC-M (Post 3055275)
Silly Ichaste, forgetting the "Super" in our favorite Ra parody's name. For shame. XD

Watch the latest TAS episode. It's being called "Mega Ultra Chicken" right now.

Obelisk the Tormentor
Monster/God/Divine Beast/Effect/12*
Atk 4000/Def 4000
By sacrificing one "Super Ultra Mega Chicken" and one "Slifer the Executive Producer" on your side of the field, you can either give this monster infinite attack points or give your opponent an epileptic seizure. By yelling "TORMENT!!!!" really, really loudly, you may cause your opponent to defy logic and attack you anyway. If you are an anime character voiced by Dan Green, you may screw the rules without money.

That last part belongs on Slifer.

Speaking of which...

Money
Normal Spell
Screw the rules.

Need I say more?

Fair enough.

And just because I can't hold this back any longer...

Kaiba's Ego
Monster/Dark/Dragon/Effect/1000*
Atk ????/Def ???
This monster's combined attack and defense is equal to how highly you think of yourself on a scale from one to ten x1000. If you are playing this monster in a duel simulator, destroy that simulator. You may only summon this monster if you have used the effect of "Money" to screw the rules.

Alright, finished. XD

Um......who won't say ten?

Scarlet Weather November 6th, 2007 4:06 PM

That's the point, you silly little man. And why would Kaiba never say ten?

And now for something completely different.

Sphere Grid
Equip Spell
When a "Wandering" monster is equipped with this spell card, you may discard two cards from your hand. If so, the effect of the selected "Wandering" monster becomes the same as that of any "Wandering" monster in your graveyard.

And now for something that's actually completely different...

Sacrificial Lambs
Normal Spell
Tribute any two tokens on your side of the field. Special summon one level seven or higher Dark monster from your deck.

Ojama Trio just received massive hate. Meh, this one I just made 'cause I felt like it. 0_o

Forci Stikane November 6th, 2007 6:22 PM

Quote:

Originally Posted by ACC-M (Post 3055556)
That's the point, you silly little man. And why would Kaiba never say ten?

Exactly. Now, stop calling me little. It bugs me...

And now for something completely different.

Sphere Grid
Equip Spell
When a "Wandering" monster is equipped with this spell card, you may discard two cards from your hand. If so, the effect of the selected "Wandering" monster becomes the same as that of any "Wandering" monster in your graveyard.

...Um, I'm not too sure if that fits the whole "Sphere grid" idea of FFX. A basic stat boost in addition might be prudent.

And now for something that's actually completely different...

Sacrificial Lambs
Normal Spell
Tribute any two tokens on your side of the field. Special summon one level seven or higher Dark monster from your deck.

Ojama Trio just received massive hate. Meh, this one I just made 'cause I felt like it. 0_o

I'm calling Stray Lambs & Scapegoat, actually. ...Dark Magician support, perhaps? ......Not much comes to mind right now in the way of 7+ Darks...

Frostweaver November 6th, 2007 7:03 PM

Winged Dragon of Ra is *only* Mega Ultra Chicken even in the movie... Super was never part of it XD;

Alter Ego November 8th, 2007 2:31 AM

Sphere Grid: so if we equip the monster without discarding we just get a neat decorative equip? xD Anyways, "If you do" rather than "If so" this card also looks a bit too expensive. A -2 and the effect is still tied to an equip? x.O I think I'd sooner run something that lets me recur the wanderer whose effect I want, especially since the wanderer you equip this to loses its original effect to boot. Should work nicely for the hero, but I think you can lower the cost to one discard. :3

Sacrificial Lambs: Well, Stray Lambs can be tributed anyway so I'd sooner go for Scapegoat or - as ACC mentioned - Ojama tokens with this. Free Dark Magician of Chaos ftw! Come to think of it, you could use Scapegoat then play this to summon the magician, use the magician's effect to recur Sacrificial Lambs and use it to summon...erm, some very powerful high-level dark attribute monster I just can't think of at the moment? xD Well, there's got to be one somewhere. Pretty neat card.


And Frostweaver hit the nail on the head with Relentless Crossout. The real power of that card is not in what it can cost your opponent (or in a freebie peek, because Dark Designator does that better) but in what it can dump for you. ^.~

Now for a card loosely based on one from another TCG (Cookie to the first who can guess the card in question)

Dark Empress Dulahey
Spellcaster/Effect
9 Star/Dark
2200 Atk / 1700 Def

This card can not be Normal Summoned or Set. This card can only be Special Summoned by removing from play three DARK Attribute monsters in your Graveyard while this card is in your Hand or Graveyard. You may only have one "Dark Empress Dulahey" on your Field at any given time. While there is at least one DARK Attribute monster on your Field other than this card, this card can not be selected as the target of an attack or card effect. When two monsters battle, both monsters are destroyed at the end of the Damage Step. (Damage Calculation is applied normally)


Aaand since the senets are stuck in my head now, I'm afraid that you shall have to suffer a...*gasp* senet monster line. O= Oh, and supports too.

Nightmare Phantom
Fiend/Effect
7 Star/Dark
2300 Atk / 2300 Def

When this card would be destroyed or removed from the Field, you may move it to an unoccupied Monster Card Zone on your Field instead. If you do, the Monster Card Zone this card was in when this effect was activated is considered to be occupied for as long as this card remains face-up on the Field. When this card battles with a monster in the same column, negate all effects of that monster for as long as this card remains on the Field.

Phantom Conductor
Fiend/Effect
4 Star/Dark
1800 Atk / 1700 Def

If your opponent summons a monster (including Flip Summon) while this card is face-up on the Field, you may move the summoned monster to another unoccupied Monster Card Zone on your opponent's Field.

Phantom Stalker
Fiend/Effect
1 Star/Dark
0 Atk / 0 Def

If there is another monster in the same column as this card, the original Atk and Def of this card become the original Atk and Def of that monster. (A face-down monster results in an Atk and Def of zero) This Attack Position card can not be destroyed in battle with a monster that has the same Atk as this card. When this card destroys a monster by Battle, you may move this card to another unoccupied Monster Card Zone on your Field.

Wailing Phantom
Fiend/Effect
3 Star/Dark
1000 Atk / 900 Def

When this card battles with a monster in the same column, you may reduce the Atk of this card to zero for Damage Calculation only. When this card is destroyed by Battle, you may Special Summon a Fiend type monster from your Deck with an Atk equal to or lower than the amount of Battle Damage you received from the battle this monster was destroyed in.

Chaos Sphere
Continuous Spell

During each of your Standby Phases, pay 400 Life Points, otherwise this card is destroyed. Once per turn, during your Main Phase, you may rearrange the cards on either player's Field in any manner you wish. (Card positions and control of cards can not be changed by this effect)

Pincer Attack
Quick-Play Spell

Select one monster on your opponent's Field and two Attack Position monsters on your Field that are located in adjacent columns to the monster on your opponent's Field. Destroy the monster you selected from your opponent's Field then inflict damage to your opponent equal to the difference between the combined Atk of the monsters selected from your Field and the Atk of the monster destroyed by this effect. (This is treated as Battle Damage inflicted by both of the selected monsters)

Senet Calling
Counter Trap

This card can only be activated when your opponent summons a monster in the same column as this card and you don't control a monster in that column. Special Summon one monster from your Hand or Graveyard with an Atk lower than or equal to the Atk of the monster your opponent summoned to the same column as this card.


Aaand just a random mindspook:

Zero Vortex
Normal Trap

This card can only be activated when a monster with 0 Atk is destroyed in battle with a monster controlled by your opponent. Destroy all monsters on your opponent's Field with an Atk higher than or equal to the Atk of the monster that destroyed your monster.

Frostweaver November 8th, 2007 10:57 AM

Dark Empress Dulahey- I have no idea x.x; either way, "meh." Turns everything into Newdoria, which makes it just as eas for the enemy to destroy the empress herself. I only see this as a RFG engine, but we have plenty of that nowadays...

Nightmare Phantom- overpowered... because you really only want this card on the field for monster, then you have a chance to score some +4 because it'll take your opponent that 4 cards to kill this thing for real. Cyber Dragon can only kill it the first time, then it'll take a monarch, and then basically nothing. Light and Darkness Dragon, Plasma and Skill Drain are in dire need against this thing x.x (and Ojama Trio). I'll say take out the atk increase each time, boost atk power to 2200 or 2300 atk and it should be fine. Then at least (true) tribute monsters can take care of it if it has no backup in spells/traps.

Phantom Conductor- fair enough

Phantom Stalker- fair enough... fun card with opti-camouflage armor to copy 2400 atk and ram it in fo direct attack X3

Wailing Phantom- damage condenser for fiends on monster form... too bad I can't think of that many fiends to use and can benefit from this x.x;

Chaos Sphere- senets really need that... a push in the right direction.

Pincer Attack- situational yet huge payback... I mean, chances of this thing doing immense damage is huge against facedown (hiiiii marshmellon and treeborn frog XD)

Senet Calling- against situational because... 1/5 chance, sort of? but it does work for *any* monster o_O;

Zero Vortex- phantom stalker abuse, now =o

Scarlet Weather November 8th, 2007 8:25 PM

Cadalbolg
Equip Spell
The monster equipped with this spell card must be "Wandering Hero" or "Wandering Swordslinger". When the selected monster declares a direct attack on your opponent's life points, the battle damage becomes half of your life points. You may not activate this effect and the effect of the equipped monster in the same turn.

Wandering Highwind
Monster/Wind/Machine/Effect/6*
Atk 2400/Def 2000
When this monster is summoned successfully, select one level four or lower "Wandering" monster in your deck and add it to your hand. When this monster is destroyed by a card effect, special summon any level four or lower "Wandering" monsters in your hand.

Tidus's ultimate weapon and cool airships FTW!

Frostweaver November 8th, 2007 11:03 PM

Cadalbolg- blah, why must we use this name instead of Ultima Weapon (in japanese, it's still the Ultima Weapon just like FF7 and FF9. English is whacko and suddenly gave it a new name.) Either way, doesn't Hero dig up equip as its effect? Then we're aiming for Hero to do direct damage, and we'll be scoring 4000 LP damage (not hard to search hero with RotA, and hero has built in search for Cadalbolg) early on... with aegis of gaia and cards like that, we're looking at a 2HKO combo. Yes I know that if you dig up the sword, you can't use it on the same turn but is it that hard to get out another copy of hero or gunslinger when they're lv 4 and warriors?

Wandering Highwind- I'm almost tempted to say why not skip the middle step and just summon the monster directly, but yes there's differences... either way, I'm not sure if wandering monsters need it. Either they're so darn searchable already, or they are higher level and can't be searched. It helps, certainly, but the usable wandering monsters seem to do very well for the most part alone. I think we need tributed wandering monsters to help out in effect/destruction/general draw instead of searchability (their support cards do that well enough without tributes.)

Frostweaver November 9th, 2007 1:57 PM

Hm, wrong thread? I think you mean Card Discussion XD;

Forci Stikane November 9th, 2007 4:57 PM

:\

Anyway......

Destiny Hero - Searchlight Lad
DARK/Warrior/Effect
3 Stars/ATK 800/DEF 1200
This card is also treated to have "Elemental Hero" in its card name. During your Standby Phase after this card is destroyed and sent to the Graveyard as a result of battle, you may select and activate 1 of the following effects:
-Draw 1 card for each face-up Level 3 or lower "Destiny Hero" or "Elemental Hero" monster on your side of the field.
-Add 1 "Destiny Hero" or "Elemental Hero" monster, except "Destiny Hero - Searchlight Lad" from your Deck or Graveyard to your hand.

D-Hero version of Stratos? :\

Bah, I'm going back to the fun ones:

Guardian of GIANT ROCKS!!!!!!
EARTH/Warrior/Effect
4 Stars/ATK 1600/DEF 800
While this card is face-up on your side of the field, face-up "GIANT ROCK!!!!" monsters on your side of the field cannot switch controllers or be destroyed by cards that designate a target.

YET ANOTHER GIANT ROCK!!!!
EARTH/Rock/Effect
4 Stars/ATK 0/DEF 2000
While face-up on your side of the field, this card is treated as a Normal Monster, and its name is treated to be "A GIANT ROCK!!!!".

GIANT ROCK BARRAGE!!!!
Normal Trap
Send 1 "GIANT ROCK!!!!" monster from your deck to your Graveyard. Inflict damage to your opponent equal to half the sent monster's DEF.

GIANT ROCK BLOCKAGE!!!!
Continuous Spell
Select 1 "A GIANT ROCK!!!!" on your side of the field and up to three unoccupied Monster card zones on your opponent's side of the field that are adjacent to each other. As long as this card is face-up on the field, the selected monster's DEF is decreased by 1000 and the selected zones cannot be used.

Eon-Rider November 9th, 2007 5:43 PM

The Greed of a Huntsman
Continuous Spell
Whenever a Monster on your side of the field inflicts 800 or more Battle Damage to your opponent, draw 1 card.

I have a feeling this card can be abused in some way but meh. XD

Frostweaver November 9th, 2007 6:28 PM

Um, yes...? I think almost all direct damage is more than 800, and monarchs against non-tribute are generally mroe than 800 too. Oh even my robbin goblion idea with submarineroid can abuse it ><; too broken.


Great Erosion
Normal Spell card

Send all "GIANT ROCK" cards to the removed pile and deal 1000 damage to your opponent for each card removed this way.


>>; yeah, a bit overboard with that many giant rock cards.


Searchlight Lad- there's probably ways to abuse it, really. It's probably the 2nd effect we're going to try to abuse too (not too many usable lv 3 and lower e/d heroes that will stay alive for long. I only know disc commander. Everything else is generally lv 4 and up.)


Forbidden Fruit of Ancient Knowledge
Normal Spell

Draw 2 cards and show it to your opponent. Remove the drawn cards from play unless they are spell cards. For each card removed from play this way, deal 500 damage to your LP. You cannot use more than 1 "Forbidden Fruit of Ancient Knowledge" per turn.

Scarlet Weather November 10th, 2007 7:06 AM

Lessee... slightly less broken anime card:

Akashic Records
Normal Spell
Your opponent draws two cards. Select two spell or trap cards from your graveyard and add them to your hand, then discard one card.

Hm... even now I'm looking at Limited, at the least, but what the hey it's thematic anyway.

Lion's Heart
Normal Spell
Special summon one "Wandering Gunblader" from your hand or deck.

Wandering Gunblader
Monster/Light/Warrior/Effect/6*
Atk 2400/ Def 2000
When this monster destroys an opponent's monster as a result of battle, flip a coin. If heads, destroy one other monster on your opponent's side of the field, regardless of position.

Griever
Equip Spell
Increase the attack points of the equipped monster by five hundred. If the equipped monster is "Wandering Gunblader", increase the equipped monster's attack points by one thousand instead. If "Wandering Gunblader" is equipped with this card, destroy any monster it battles with at the end of the turn.

Wandering Guardian
Monster/Dark/Warrior/Effect/6*
Atk 2400/Def 2000
When this monster battles with a defense-position monster and this monster's attack points are higher then the other monster's defense points, subtract the difference for the opponent's life points. If another "Wandering" monster is on your side of the field when this monster is summoned, your opponent may not conduct their next battle phase.

Any questions, gentlemen?

Alter Ego November 10th, 2007 7:33 AM

Actually, Dulahey only turns everything into Yomi Ship because Newdoria gets to pick and choose its victims. Besides, the vulnerability to her own effect is why I added that Command Knight-style protection effect. O= The vulnerability to its own effect was part of the monster this is based on, though, so I couldn't leave that out it in good conscience. Nightmare Phantom has been edited, though. :3

The Greed of a Huntsman: anything that does battle damage and isn't called Crystal Beast exploits this like crazy. D=

Forbidden Fruit: Spell-heavy decks will love this, yes they will. For a really animesque synergy, Soul Absorption prevents turns the end sum of the transaction zero regardless of how many or few get removed. xD But yeah, that's obviously not the sort of thing you'd play this card for. ^^

Akashic Records: So...what happens to that other spell or trap we're selecting? I mean, is it just selected for the heck of it or what? x.O

Lion's Heart: Now that's just plain lazy. What ever happened to tribute summoning your monsters? xP

Wandering Gunblader: Are you going to replicate ever FF character out there? o.O Well anyways, the coin flip suits the trigger, but destroying another monster seems sort of odd. How about having it do something like extra damage or increasing the gunblader's Atk (though the timing would obviously have to be changed for that) instead?

Griever: so not worth it. Bumped up to 3400 Atk and with a destruction effect to boot the second part of this won't ever come to use, and if we just want 1000 Atk we've already got Axe of Despair and that's not worth it either. O=

Wandering Guardian: Overpowered. It's like Dark Driceratops with a major additional effect. I'd say cut down on the effects or the stats.

Anyways, time for a super special awesome new win condition:

Rule of the Immortal
Normal Spell

When you have 20 000 Life Points or more, you may show this card in your Hand to your opponent in order to declare automatic victory. Send this card in your Hand to the Graveyard in order to select one Spell or Trap card with an effect that increases your Life Points from your Graveyard and add it to your Hand.

'Cause life points need more value. x3 Oh, and I'd be much obliged if someone finally reviewed the royals I posted like...a page ago:

Spoiler:
Quote:

Originally Posted by Alter Ego (Post 3034577)
Queen Curran
Spellcaster/Effect
8 Star/Dark
3000 Atk / 0 Def

This card can not be Normal summoned or Set. This card can only be Special Summoned by the effect of "The Final Trial". While this card is face-up on the Field, the effects of your Trap Cards can not be negated. Each time a monster other than a "Curran", "Pikeru" or "Royal" monster is summoned (Including Flip Summon), inflict 800 Damage to the player who summoned it.

Queen Pikeru
Spellcaster/Effect
8 Star/Light
3000 Atk / 0 Def

This card can not be Normal summoned or Set. This card can only be Special Summoned by the effect of "The Final Trial". While this card is face-up on the Field, the effects of your Spell Cards can not be negated. Each time a monster other than a "Curran", "Pikeru", or "Royal" monster is summoned (Including Flip Summon), the opponent of the player who summoned it gains 1200 Life Points.

Court of Nobles
Field Spell

While this card is face-up on your Field, increase the Atk of all "Curran", "Pikeru", and "Royal" monsters by 300. During your Draw Phase, instead of drawing a card, you may add one Spell Card that mentions a "Curran" or "Pikeru" monster in its card effect from your Deck to your Hand.

The Final Trial
Continuous Spell

Each time you inflict Direct Damage to your opponent while "Princess Curran" is face-up on your Field, place one Ebon Counter on this card (Maximum 3). Each time you gain Life Points while "Princess Pikeru" is face-up on your Field, place one White Counter on this card (Maximum 3). Remove three Ebon Counters from this card and tribute "Princess Curran" on your Field to Special Summon one "Queen Curran" from your Hand or Deck. Remove three White Counters from this card and tribute "Princess Pikeru" on your Field to Special Summon one "Queen Pikeru" from your Hand or Deck. When this card would be destroyed, you may discard one card from your Hand instead.

Royal Chaplain
Spellcaster/Effect
4 Star/Light
1400 Atk / 1200 Def

Once per turn, tribute one Spell or Trap card on your Field to negate the Special Summon of a monster controlled by your opponent and destroy it. If "Court of Nobles" is face-up on your Field, you may use this effect to negate the Normal Summon of a monster controlled by your opponent instead.

Royal Spy
Spellcaster/Effect
3 Star/Dark
1200 Atk / 800 Def

While this card is face-up on the Field, you may look at your opponent's Hand. Once per turn, when your opponent sets a Spell or Trap card from his/her Hand while "Court of Nobles" is face-up on your Field, discard one card of the same type as the one your opponent set (Spell or Trap) in order to destroy the set card.

Royal Cavalry
Warrior/Effect
7 Star/Earth
2600 Atk / 2200 Def

While there is a face-up "Curran" or "Pikeru" monster on your Field, this card can be Normal Summoned with only one tribute. When this card attacks, if "Court of Nobles" is face-up on your Field, your opponent may not activate any card effects until the end of the Damage Step.

Hereditary Right
Continuous Trap

While there is at least one monster in your Graveyard with the same name as a monster on your Field, the effect(s) of the monster on your Field can not be negated by any other card effects. Remove from play one monster in your Graveyard to negate the activation and effect of a card that would negate the summoning of a monster with the same name and destroy it.

Sacrifice of the Highborn
Counter Trap

Discard one "Curran", "Pikeru" or "Royal" monster from your Deck to negate the effect of a Spell or Trap Card that designates a monster on your Field and destroy it.


Marauding Master November 10th, 2007 8:41 AM

Why is my Jinzo removed? o.o;

Frostweaver November 10th, 2007 9:49 AM

(probably because Jinzo is already a real card? XD; )

Forci Stikane November 10th, 2007 12:15 PM

Quote:

Originally Posted by Alter Ego (Post 3066673)
Oh, and I'd be much obliged if someone finally reviewed the royals I posted like...a page ago:

Fine, but in exchange you have to review my cards at the top of the page that were ignored. ;)

Queen Curran: The ATK is a bit too high (2700 would be better, methinks). The effect itself...well, clear Decree-hate and would have been lovely synergy with Decree/Order if IO was still around...but that burn effect is, ehh......a bit hefty. Also, what about cards like Ojama Trio & Lave Golem? Suddenly you're taking a big chunk of damage for it or giving it to your opponent? Either way, it's either quite broken or quite painful. XD

Queen Pikeru: ...>_> BAD REACTION TO SIMOCHI FTW!!!!!!!!!!!!!!

Court of Nobles: Meh.

The Final Trail: So it stays on the field now? Hmm, definitely makes it a bit easier to pull both out at once.

Royal Chaplain: ......Would this work with the last part of The Final Trail's effect? Regardless, though, there's definite potential for this, but Zombie might chuckle a bit...

Royal Spy: knowing what's coming is always a good thing, but the discarding effect is pretty good. Certainly better than Tributing them, as Chaplain's already got that covered.

Royal Cavalry: I think you mean "Ancient Royal Gear"...but 2500 and unstoppable except by monsters? Not bad at all.

Hereditary Right: I'm looking at abuse here with searchers and Royals. It also gives you something else to do with those discards.

Sacrifice of the Highborn: Case in point. The extra copies of the Queens you've got suddenly have a use. It also adds to that whole "Royal protection" dynamic...


Quote:

Originally Posted by Marauding Master (Post 3066913)
Why is my Jinzo removed? o.o;

Probably because it was SPAM. This is the "You Make the Card!" thread, not the "Post Already-Made Cards!" thread...

Marauding Master November 10th, 2007 5:03 PM

Actually it was an Ultimate Rare Jinzo I made and I'd like to put it here.

Forci Stikane November 10th, 2007 5:22 PM

.........Sorry everybody, but I need to get this off my chest here:

Quote:

Originally Posted by Marauding Master (Post 3068877)
Actually it was an Ultimate Rare Jinzo I made and I'd like to put it here.

Seriously, I don't think anybody cares about that sort of edit. If we did, there would probably already be a lot more, including the one you tried to post. Did you make the artwork for Jinzo? No. Did you make the effect and stats, send that information to Konami, and have them make it? No. Therefore, you did not make the actual card itself and it does not belong here. All what you did amounts to would be something like a recolor, and as we all know, recoloring =/= making.



......*phew* I feel better. So much so, in fact, that I could just...just.......


GIANT ROCK.......IN AMERICA!!
Normal Trap
When a "A GIANT ROCK!!!!" on your side of the field is attacked, negate the attack and destroy all cards in the same column as the attacked card.

Anime Mullet
Equip Spell
Switch the ATK & DEF of the equipped monster. If the equipped monster is "A GIANT ROCK!!!!" or "ANOTHER GIANT ROCK!!!!", whenever the equipped monster destroys a monster as a result of battle, destroy 1 Spell or Trap card on your opponent's side of the field and inflict 400 points of damage to his/her Life Points.

Scarlet Weather November 10th, 2007 9:09 PM

Um... you misunderstand the purpose of this thread. You don't make cards in a new format here: you create new cards with completely different effects. Learn the difference.

As to the comment on the Wandering monsters, of course I'm not doing every character in Final Fantasy. I've only played seven, eight, and ten after all. XD

WILL THERE BE NO END TO THIS CEASELESS WANDERING!?!?!?
Normal Trap
Tribute all "Wandering" monsters you control. Send all cards in your opponent's hand and all monsters on their field to the graveyard. You must have three or more "Wandering" monsters with different names on your field in order to activate this card.

Broken or no?

Bypass Tribute
Normal Spell
Activate only when you have no other monsters on your side of the field. Special summon one level six or higher monster from your hand.

Gifts of the Dead
Quickplay Spell
Draw one card for each monster your opponent special summoned during their last turn.

I need to do something with the rocks, so...

BEHOLD THE GIANT ROCK!!!!!
Normal Spell
Tribute one "GIANT ROCK!!!!" or "ANOTHER GIANT ROCK!!!!!!" that you control. Special summon one "Major Skeptic" or "PRIESTESS OF THE GIANT ROCKS!!!" from your deck.

PRIESTESS OF THE GIANT ROCKS!!!
Monster/Earth/Spellcaster/Effect/4*
Atk ????/Def ????
All monsters with "GIANT ROCK" in their card names gain one thousand attack points as long as this monster is on the field. The attack and defense of this monster are equal to half of the total combined attack and defense of all "GIANT ROCK" monsters you control.

Major Skeptic
Monster/Dark/Warrior/Effect/6*
Atk 2400/Def 0000
Control of this monster is switched to your opponent when it is summoned. Whenever this monster battles with a monster with "GIANT ROCK" in its name, destroy this monster without applying damage calculation and inflict three thousand points of direct damage to your opponent's life points.

Alter Ego November 11th, 2007 4:03 AM

Quote:

Originally Posted by Ichaste Pekoni (Post 3067682)
Queen Pikeru: ...>_> BAD REACTION TO SIMOCHI FTW!!!!!!!!!!!!!!

Sure, if we want to hinge our strategy on a monster that can only be summoned by a specific card effect that requires you to tribute a monster that can only be summoned by another specific card effect. xP Personally, I'd sooner go for Dark Eradicator Warlock burn (Toon Table searches Toon Table searches Toon Table, Transmigration kicks in, Toon Table searches Toon Table searches Cannon Soldier. 5000 points plus the ability to tribute everything you have on the field for 500 points each; throw in two more Normal Spells and that's 8000 already) but yeah; seeing as how Scapegoat + Simochi now equal 8000 burn I suppose I'll cut it down to 1200 per summon.

Quote:

Originally Posted by Ichaste Pekoni (Post 3067682)
that burn effect is, ehh......a bit hefty

Original was 900 for every monster each turn so that one is toned down, actually. This way it only stings once. Oh, and the person who summons (as opposed to the person who gets it) is the one who's footing the bill, so there's no Ojama exploit. There is some considerable Scapegoat hate, though. x3 Fine, I'll drop it to 800 per summon.

As for their Atk...well, compared to The Splendid Venus (Spell and trap anti-negation in one package and a far easier summon) these are pretty tame so I think it's only fair to give them 200 more base Atk. It's not like they cut the Atk of all non-royals either. xP

Quote:

Originally Posted by Ichaste Pekoni (Post 3067682)
Royal Chaplain: ......Would this work with the last part of The Final Trail's effect? Regardless, though, there's definite potential for this, but Zombie might chuckle a bit...

If you're referring to using Trial's self-protection effect as a way to convert the cost into a discard then no. Chaplain specifies that you must tribute but trial is only protected from destruction effects.


And yeah, sacrifice and Hereditary Right do have intentional synergy. *Shot* Still, exploiting the latter calls for some careful setup and it's only fair that Skill Drain Burn got a counter-measure to face. xP


Guardian of GIANT ROCKS!!!!!!: hiii Shield Crash, Brain Control and Soul Exchange. Another way to keep the rock safe for potential OTKOing and this has decent stats too. :3

YET ANOTHER GIANT ROCK!!!!: Oh come now, there are only two giant rocks. This monster is such a wannabe. D=

GIANT ROCK BARRAGE!!!!: So basically 1500 or 1000 burn and dump a rock for retrieval? Whoa, regular Rock Barrage just got pwned. GIANT ROCK burn is getting more and more viable.

GIANT ROCK BLOCKAGE!!!!: Combine with Ground Collapse and the Def drop really isn't an issue anymore. Ehh...fair enough, and certainly dead annoying.

GIANT ROCK.......IN AMERICA!!: Why is there nothing American in the card effect? Heresy! And totally overshadowed by Blasting Fuse too. :<

Anime Mullet: Now this is just plain random. Basically an equip made solely for giant rocks and - possibly - Big Shield Gardna or Gear Golem.


WILL THERE BE NO END TO THIS CEASELESS WANDERING!?!?!?: Ehh...yeah, one-sided Norleras is broken no matter how you slice it. Even the crazily picky cards like Law of the Normal (Requires five level 2 or lower normal monsters on your field) hit both players, because let's face it; that's the only way to balance an effect this strong. .__.

Bypass Tribute: What do you mean other monsters? This is a spell; not a monster, so remove that word. Other than that...I guess it's a fair enough; sort of reminds me of Cost Down except it has no discard and is a lot more limited in its application. Love the way this lets me plunk down Satellite Cannon on turn one. xD

Gifts of the Dead: pretty misguiding name since it doesn't specify that they have to come from the graveyard. Definite use against zombie, but I'm generally not too fond of cards that rely on my opponent making specific plays.


And I just don't have the energy to comment on more GIANT ROCK cards anymore. Seriously, guys, haven't we exhausted the possibilities with those already? All these caps and exclamation marks are violating my aesthetic sense. ;_;

Anyways:

Royal Stronghold
Field Spell

This card is treated as "Court of Nobles". This card can only be activated if "Court of Nobles" is face-up on your Field. Increase the Atk and Def of all "Curran", "Pikeru" and "Royal" monsters on the Field by 300 and reduce the Atk and Def of all other monsters on the Field by the same amount. During your Draw Phase, you may add one Spell or Trap card designating a "Curran", "Pikeru" or "Royal" monster in its card effect from your Deck or Graveyard to your Hand instead of drawing a card. When this face-up card on the Field would be destroyed, you may discard one "Royal" monster from your Hand instead.

Curran's Circle of Disenchantment
Normal Trap

Pay 1000 Life Points to activate this card. Until your second Standby Phase after this card's activation, monsters on the Field are not affected by the effects of any Spell or Trap cards.

Shield of Heredity
Equip Spell

Only once per equipped monster, you may negate the effect of card that designates the monster equipped with this card and destroy it. If this face-up card on your Field was sent to your Graveyard other than as the result of a card effect and you successfully summon a monster with the same name as the monster this card was equipped to when it was sent to the Graveyard, equip this card to the monster you summoned.


Yes, the last one is probably not very useful. So sue me. xD Anyways, you haven't played FF VI, ACC? Oh, you poor soul. O= That prompts me to create:


Wandering Artist
Spellcaster/Effect
3 Star/Light
1000 Atk / 800 Def

When this card is summoned successfully (Including Flip Summon) select one face-up monster on the Field other than this card then increase the original Atk and Def of this card by half the Atk and Def of the selected monster for as long as this card remains face-up on the Field.

Wandering Assassin
Warrior/Effect
5 Star/Dark
1300 Atk / 700 Def

When this card attacks, if this card was Tribute Summoned using a "Wandering" monster, destroy the attacked monster with this card's effect without applying Damage Calculation.

Wandering Canine
Beast/Union/Effect
3 Star/Earth
1000 Atk / 0 Def

If "Wandering Assassin" is face-up on your Field, you can Special Summon this card from your Hand. Once per turn, during your Main Phase, if you control this card on the field, you can equip it to your "Wandering Assassin" as an Equip Card, OR unequip the Union equipment and Special Summon this card in face-up Attack Position. (1 monster can only be equipped with 1 Union Monster at a time. If the equipped monster is destroyed as a result of battle, destroy this card instead.) Increase the Atk of the monster equipped with this card by 700. If the equipped monster would be destroyed or removed from the Field as the result of a card effect, destroy this card instead. If this card is destroyed while it is equipped to "Wandering Assassin", the monster this card was equipped to can not be destroyed or removed from the Field until the end of the turn.

Wandering Engineer
Warrior/Effect
4 Star/Earth
1600 Atk / 1700 Def

Once per turn, discard one card from your Hand in order to add one Equip Spell card from your Graveyard to your Hand. When this card destroys a monster by battle, you may send one Equip Spell card equipped to this card to the Graveyard. If you do, this card may attack once more in a row.

Wandering Fighter
Warrior/Effect
4 Star/Fire
1800 Atk / 1300 Def

This card can not be destroyed except by Battle.

Wandering Gambler
Spellcaster/Effect
3 Star/Wind
? Atk / ? Def

Once per turn, during your Main Phase, roll a six-sided die three times then select two of the results. The original Atk and Def of this card becomes the combined value of the results you selected x 300 until your next Standby Phase.

Wandering General
Spellcaster/Effect
6 Star/Light
2100 Atk / 1700 Def

Once per turn, discard one card from your Hand to negate the activation and effect of a Spell Card controlled by your opponent and destroy it.

Wandering Knight
Warrior/Effect
6 Star/Fire
2300 Atk / 1600 Def

When this card attacks, the target monster is switched into Attack Position. (card effects are not activated)

Wandering Mimic
Spellcaster/Effect
4 Star/Dark
? Atk / ? Def

Whenever this card attacks or is attacked, select one face-up monster on the Field other than the monster this card battles with. This card gains the Atk, Def and card effect(s) of the selected monster until the end of the Damage Step.

Wandering Moogle
Fairy/Effect
4 Star/Light
1400 Atk / 800 Def

If there is a face-up Field Spell on the Field, this card accumulates effects depending on the effect(s) of that card:

- Change Atk or Def: Increase the original Atk of this card by 500.
- Decrease Battle Damage: All Battle Damage you receive from battles involving "Wandering" monsters is reduced to zero.
- Draw a card(s): During your Main Phase, you may draw a card. This card can not attack on the turn this effect is activated.
- Negate the destruction of a card(s): Once per turn, when this card would be destroyed by battle it is not destroyed.
- Destroy a monster(s): Once per turn, you may select a face-up monster on the Field and destroy it. On the turn this effect is activated, this card may not attack.
- Change monster level: all "Wandering" monsters in your Hand and on your Field are considered to be one level lower than usual.

Wandering Sage
Spellcaster/Effect
7 Star/Earth
2300 Atk / 2100 Def

When Tribute Summoning this card, all tributes must be "Wandering" monsters. If this card was Tribute Summoned it gains the following effect:

- Once per turn, discard one Normal Spell card from your Hand in order to activate the effect of an Effect Monster from either player's Graveyard, ignoring activation requirements.

Wandering Sasquatch
Beast/Effect
6 Star/Water
2600 Atk / 1300 Def

If "Wandering Moogle" is face-up on your Field, this card can be Special Summoned from your Hand. This card can not be set and must attack each turn if able. If this card is in face-up Defense Position, destroy it.

Wandering Treasure Hunter
Warrior/Effect
5 Star/Wind
2000 Atk / 1100 Def

When this card inflicts Battle Damage to your opponent, select one Spell or Trap card from your opponent's Graveyard and add it to your Hand, then you can use the selected card in this duel. When the face-up card is sent to the Graveyard, it is placed in the Graveyard of the original owner.

Wandering Wildchild
Warrior/Effect
3 Star/Earth
1300 Atk / 800 Def

When this card battles, instead of applying Damage Calculation, you may remove this card from play until your next Standby Phase. (The Monster Card Zone this card was in is treated as occupied during this time) When this card is returned to your Field after using this effect, this card copies the Atk and Def of the monster it attacked.

Wandering Witch
Spellcaster/Effect
7 Star/Light
2200 Atk / 1400 Def

While this card is face-up on the Field, all of your Spell Cards are treated as Quick-Play in addition to their normal type.


*Dies* Did I miss anyone? xD Now for the limit break (well, the best I can do with the freakin' unified limit break system they ran back then anyway):

Limit Break - Debiliator

Normal Spell

This card can only be activate by paying half your Life Points while "Wandering Engineer" is face-up on your Field. Until your second Standby Phase after this card's activation, negate the effects of all Effect Monsters controlled by your opponent. If "Wandering Engineer" is the only monster on your Field, you do not need to pay any Life Points to activate this effect. You may only activate the effect of one "Limit Break" Spell Card each turn.

Limit Break - Feral Rage

Normal Spell

This card can only be activated by paying half your Life Points while "Wandering Wildchild" is face-up on your Field. Select one Monster Card from your Deck or from either player's Field or Graveyard. Until your second Standby Phase after this card's activation, "Wandering Wildchild" gains the Atk, Def and effects of the monster you selected. If "Wandering Wildchild" is the only monster on your Field, you do not need to pay any Life Points to activate this effect. You may only activate one "Limit Break" Spell Card each turn.

Limit Break - Runic
Normal Spell

This card can only be activated by paying half your Life Points while "Wandering General" is face-up on your Field. Check all cards on your opponent's Field and in his/her Hand as well as every card he/she draws until your next Standby Phase after this card's activation then remove all Spell Cards you find from play. For every two Spell Cards removed from play by this effect, select one Spell Card from your Graveyard and shuffle it into your Deck. If "Wandering General" is the only monster on your Field, you do not need to pay any Life Points to activate this effect. You may only activate one "Limit Break" Spell Card each turn.


More to come when I figure them out. :3

Marauding Master November 11th, 2007 11:07 AM

Quote:

Originally Posted by Ichaste Pekoni (Post 3068928)
.........Sorry everybody, but I need to get this off my chest here:



Seriously, I don't think anybody cares about that sort of edit. If we did, there would probably already be a lot more, including the one you tried to post. Did you make the artwork for Jinzo? No. Did you make the effect and stats, send that information to Konami, and have them make it? No. Therefore, you did not make the actual card itself and it does not belong here. All what you did amounts to would be something like a recolor, and as we all know, recoloring =/= making.



......*phew* I feel better. So much so, in fact, that I could just...just.......


GIANT ROCK.......IN AMERICA!!
Normal Trap
When a "A GIANT ROCK!!!!" on your side of the field is attacked, negate the attack and destroy all cards in the same column as the attacked card.

Anime Mullet
Equip Spell
Switch the ATK & DEF of the equipped monster. If the equipped monster is "A GIANT ROCK!!!!" or "ANOTHER GIANT ROCK!!!!", whenever the equipped monster destroys a monster as a result of battle, destroy 1 Spell or Trap card on your opponent's side of the field and inflict 400 points of damage to his/her Life Points.

Better stolen and improved than poorly made up.

Alter Ego November 11th, 2007 11:14 AM

Quote:

Originally Posted by Marauding Master (Post 3071992)
Better stolen and improved than poorly made up.

Not in this thread. The only requirements are that the card is made up and would function within the mechanics of its alloted TCG. Icha's conformed to these rules; yours didn't. Yours got deleted; Icha's didn't. End of story. Now could you two please stop sniping at each other or take it over PM? Or could you at the very least do it in a thread where it's not off topic? I hate to be a mini-mod, but this is getting really annoying. -.-

Forci Stikane November 11th, 2007 2:26 PM

Quote:

Originally Posted by Alter Ego (Post 3072016)
Not in this thread. The only requirements are that the card is made up and would function within the mechanics of its alloted TCG. Icha's conformed to these rules; yours didn't. Yours got deleted; Icha's didn't. End of story. Now could you two please stop sniping at each other or take it over PM? Or could you at the very least do it in a thread where it's not off topic? I hate to be a mini-mod, but this is getting really annoying. -.-

Agreed (I was actually finished after that last one...).

Now, to bring everything back to the main topic:

Quote:

Originally Posted by Alter Ego (Post 3070771)
Original was 900 for every monster each turn so that one is toned down, actually. This way it only stings once. Oh, and the person who summons (as opposed to the person who gets it) is the one who's footing the bill, so there's no Ojama exploit. There is some considerable Scapegoat hate, though. x3 Fine, I'll drop it to 800 per summon.

I figured as much. Zombie & Big City are still officially cursing you out, though. XD

GIANT ROCK.......IN AMERICA!!: Why is there nothing American in the card effect? Heresy! And totally overshadowed by Blasting Fuse too. :<

Mount Rushmore, anyone? ......That one mountain in Washington works, too. :P

WILL THERE BE NO END TO THIS CEASELESS WANDERING!?!?!?: Ehh...yeah, one-sided Norleras is broken no matter how you slice it. Even the crazily picky cards like Law of the Normal (Requires five level 2 or lower normal monsters on your field) hit both players, because let's face it; that's the only way to balance an effect this strong. .__.

There's also the fact that, being Warriors, the Wandering monsters are going to be really easy to toss out three of.

And I just don't have the energy to comment on more GIANT ROCK cards anymore. Seriously, guys, haven't we exhausted the possibilities with those already? All these caps and exclamation marks are violating my aesthetic sense. ;_;

But it has so much potential!!!! XD

Anyways:

Royal Stronghold
Field Spell

This card is treated as "Court of Nobles". This card can only be activated if "Court of Nobles" is face-up on your Field. Increase the Atk and Def of all "Curran", "Pikeru" and "Royal" monsters on the Field by 300 and reduce the Atk and Def of all other monsters on the Field by the same amount. During your Draw Phase, you may add one Spell or Trap card designating a "Curran", "Pikeru" or "Royal" monster in its card effect from your Deck or Graveyard to your Hand instead of drawing a card. When this face-up card on the Field would be destroyed, you may discard one "Royal" monster from your Hand instead.

...Didn't Court of Nobles or something have an effect that prevented it from being destroyed, completely ruining this card due to its activation condition?? Hmm....

Curran's Circle of Disenchantment
Normal Trap

Until your second Standby Phase after this card's activation, monsters on your Field are not affected by the effects of any Spell or Trap cards.

...Skill Drain Burn, anyone?? Or just plain beatdown???? Really, this is just TOO evil... I mean, you could even combo this with RftDD or something. At least give it another cost...!

Shield of Heredity
Equip Spell

Only once per equipped monster, you may negate the effect of card that designates the monster equipped with this card and destroy it. If this face-up card on your Field was sent to your Graveyard other than as the result of a card effect and you successfully summon a monster with the same name as the monster this card was equipped to when it was sent to the Graveyard, equip this card to the monster you summoned.

"Only once per equipped monster"? I think that needs to be reworded a bit. Otherwise...meh. Takes too long to really be any use.

Yes, the last one is probably not very useful. So sue me. xD Anyways, you haven't played FF VI, ACC? Oh, you poor soul. O= That prompts me to create:

*GASP* ACC's never played FF VI!!???? OH NO!!!!!!!

Wandering Artist
Spellcaster/Effect
3 Star/Light
1000 Atk / 800 Def

When this card is summoned successfully (Including Flip Summon) select one face-up monster on the Field other than this card then increase the original Atk and Def of this card by half the Atk and Def of the selected monster for as long as this card remains face-up on the Field.

...4-star, please? I don't think we can have a 2200-ATK (after selecting a Monarch) beatstick that's immune to Gravity Bind & LLAB running around...

Wandering Assassin
Warrior/Effect
5 Star/Dark
1300 Atk / 700 Def

When this card attacks, if this card was Tribute Summoned using a "Wandering" monster, destroy the attacked monster with this card's effect without applying Damage Calculation.

...I dunno, Shadow always struck me as more of a Ninja than an actual assassin...or both, if you prefer. It seems like there should be some sort of Trap disarmament somewhere here...but it's fine as-is.

Wandering Canine
Beast/Union/Effect
3 Star/Earth
1000 Atk / 0 Def

If "Wandering Assassin" is face-up on your Field, you can Special Summon this card from your Hand. Once per turn, during your Main Phase, if you control this card on the field, you can equip it to your "Wandering Assassin" as an Equip Card, OR unequip the Union equipment and Special Summon this card in face-up Attack Position. (1 monster can only be equipped with 1 Union Monster at a time. If the equipped monster is destroyed as a result of battle, destroy this card instead.) If the equipped monster would be destroyed or removed from the Field as the result of a card effect, destroy this card instead. If this card is destroyed while it is equipped to "Wandering Assassin", the monster this card was equipped to can not be destroyed or removed from the Field until the end of the turn.

I'm asking for a 500-700 ATK boost to Shadow when equipped, but otherwise very fitting.

Wandering Engineer
Warrior/Effect
4 Star/Earth
1600 Atk / 1700 Def

Once per turn, discard one card from your Hand in order to add one Equip Spell card from your Graveyard to your Hand. When this card destroys a monster by battle, you may send one Equip Spell card equipped to this card to the Graveyard. If you do, this card may attack once more in a row.

Shield of Heredity, anyone? I think Ben Kai does a better job at attacking, though...but this is definite Ben Kai material.

Wandering Fighter
Warrior/Effect
4 Star/Fire
1800 Atk / 1300 Def

This card can not be destroyed except by Battle.

...Where're the Blitzes? =O

Wandering Gambler
Spellcaster/Effect
3 Star/Wind
? Atk / ? Def

Once per turn, during your Main Phase, roll a six-sided die three times then select two of the results. The original Atk and Def of this card becomes the combined value of the results you selected x 300 until your next Standby Phase.

Same problem as Artist.

Wandering General
Spellcaster/Effect
6 Star/Light
2100 Atk / 1700 Def

Once per turn, discard one card from your Hand to negate the activation and effect of a Spell Card controlled by your opponent and destroy it.

Permanent Magic Jammer......I like it.

Wandering Knight
Warrior/Effect
6 Star/Fire
2300 Atk / 1600 Def

When this card attacks, the target monster is switched into Attack Position. (card effects are not activated)

Hmm. Not bad, but there'll probably be quite a few times when you'll want them in Defense instead.

Wandering Mimic
Spellcaster/Effect
4 Star/Dark
? Atk / ? Def

Whenever this card attacks or is attacked, select one face-up monster on the Field other than the monster this card battles with. This card gains the Atk, Def and card effect(s) of the selected monster until the end of the Damage Step.

Ring of Magnetism + Wandering Mimic + random beatstick/wall (A GIANT ROCK!!!!) = lock.

Wandering Moogle
Fairy/Effect
4 Star/Light
1400 Atk / 800 Def

If there is a face-up Field Spell on the Field, this card accumulates effects depending on the effect(s) of that card:

- Change Atk or Def: Increase the original Atk of this card by 500.
- Decrease Battle Damage: All Battle Damage you receive from battles involving "Wandering" monsters is reduced to zero.
- Draw a card(s): During your Main Phase, you may draw a card. This card can not attack on the turn this effect is activated.
- Negate the destruction of a card(s): Once per turn, when this card would be destroyed by battle it is not destroyed.
- Destroy a monster(s): Once per turn, you may select a face-up monster on the Field and destroy it. On the turn this effect is activated, this card may not attack.
- Change monster level: all "Wandering" monsters in your Hand and on your Field are considered to be one level lower than usual.

...What sort of crazy Field Spell do we currently have that......oh, Rainbow Ruins. That's the only case where at least half of those effects will ever come into play, though...at least, as far as what comes to mind.

Wandering Sage
Spellcaster/Effect
7 Star/Earth
2300 Atk / 2100 Def

When Tribute Summoning this card, all tributes must be "Wandering" monsters. If this card was Tribute Summoned it gains the following effect:

- Once per turn, discard one Normal Spell card from your Hand in order to activate the effect of an Effect Monster from either player's Graveyard, ignoring activation requirements.

So, does that include effects that activate on Battle Damage inflicted, like Kycoo's?

Wandering Sasquatch
Beast/Effect
6 Star/Water
2600 Atk / 1300 Def

If "Wandering Moogle" is face-up on your Field, this card can be Special Summoned from your Hand. This card can not be set and must attack each turn if able. If this card is in face-up Defense Position, destroy it.

Beefed-up Berserk Gorilla. Painful if Mog's out there.

Wandering Treasure Hunter
Warrior/Effect
5 Star/Wind
2000 Atk / 1100 Def

When this card inflicts Battle Damage to your opponent, select one Spell or Trap card from your opponent's Graveyard and place it face-up in your Deck, then shuffle your Deck. You can use the face-up card in this duel. When the face-up card is sent to the Graveyard, it is placed in the Graveyard of the original owner.

>_> For a monster that gets run over by Cyber Dragon, the least you could do would be add it straight to the hand.

Wandering Wildchild
Warrior/Effect
3 Star/Earth
1300 Atk / 800 Def

When this card battles, instead of applying Damage Calculation, you may remove this card from play until your next Standby Phase. (The Monster Card Zone this card was in is treated as occupied during this time) When this card is returned to your Field after using this effect, this card copies the Atk and Def of the monster it attacked.

*GAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAU!!!!!!!!!!!!*

....That means "I like it."


Wandering Witch
Spellcaster/Effect
7 Star/Light
2200 Atk / 1400 Def

While this card is face-up on the Field, all of your Spell Cards are treated as Quick-Play in addition to their normal type.

...I think I made a card with that same effect......yeah, I'm SURE I did!

*Dies* Did I miss anyone? xD Now for the limit break (well, the best I can do with the freakin' unified limit break system they ran back then anyway):

...I'm guessing Terra's the witch, but......where's Kefka!!??????


Limit Break - Debiliator

Normal Spell

This card can only be activate by paying half your Life Points while "Wandering Engineer" is face-up on your Field. Until your second Standby Phase after this card's activation, negate the effects of all Effect Monsters controlled by your opponent. If "Wandering Engineer" is the only monster on your Field, you do not need to pay any Life Points to activate this effect. You may only activate the effect of one "Limit Break" Spell Card each turn.

Curran's Circle of Disenchantment + this = possible OTKO.


Limit Break - Feral Rage

Normal Spell

This card can only be activated by paying half your Life Points while "Wandering Wildchild" is face-up on your Field. Select one Monster Card from your Deck or from either player's Field or Graveyard. Until your second Standby Phase after this card's activation, "Wandering Wildchild" gains the Atk, Def and effects of the monster you selected. If "Wandering Wildchild" is the only monster on your Field, you do not need to pay any Life Points to activate this effect. You may only activate one "Limit Break" Spell Card each turn.

No comment.

Limit Break - Runic
Normal Spell

This card can only be activated by paying half your Life Points while "Wandering General" is face-up on your Field. Check all cards on your opponent's Field and in his/her Hand then remove all Spell Cards you find there from play. For every two Spell Cards removed from play by this effect, select one Spell Card from your Graveyard and shuffle it into your Deck. If "Wandering General" is the only monster on your Field, you do not need to pay any Life Points to activate this effect. You may only activate one "Limit Break" Spell Card each turn.


More to come when I figure them out. :3

......Runic seems kind of......watered down?

Scarlet Weather November 11th, 2007 7:01 PM

Ahem...

A Wandering Annoyance
Monster/Water/Warrior/Effect/10000000*
Atk 0000/Def 0000
When this monster is summoned, you will be forced to listen to pointless one-liners about how joke cards are poorly made-up and why Ultimate Rare Jinzo is teh c00lorz. In addition, your opponent will act like Tacey Edgeworth from "CARD GAMES" except without the royals for the remainder of the duel.

Insulting people with children's trading cards is fun!

Yokai Mountain
Field Spell
The attack of all face up "Yokai" monsters is increased by three hundred. During your standby phase, you may special summon a "Yokai" monster that was tributed by its own effect during your last turn. If you use this effect, skip your main phase two that turn.

Yoko Yokai
Monster/Fire/Beast/Effect/4*
Atk 1600/ Def 1400
Once during your main phase, tribute this monster in order to look at the top card of your opponent's deck. If that card is a monster, inflict direct damge to your opponent equal to half of that monster's original attack. (Monsters with ???? attack are considered to have zero attack points.)

Ooh... card set begins...

Scytheteen November 11th, 2007 8:25 PM

I used to mave leik, and entire page of word filled with fake cards. For now my juices ain't quite running but I came up w/ this

Mousketeer
Beast/Effect
3 Stars/Dark
200 atk./1000 def.

When this monster stays in attack mode for three turns, you may sacrafice it and send out a Moustalons

Moustalons
Beast/Effect
6 stars/Dark
1800 atk./300 def.

This monster can only be summoned in sacrafice by Mousketeer. Once this monster stays in defense for three turns you may sacrafice it for a Ratamite.

Ratamite
Beast/Effect
8 stars/Dark
3500 atk./3500 def.

This monster can only be summoned if sacraficed by Moustalons. You may attack two times a turn at the coast of 500 LP.

Alter Ego November 12th, 2007 2:52 AM

Quote:

Originally Posted by Ichaste Pekoni (Post 3072233)
...Didn't Court of Nobles or something have an effect that prevented it from being destroyed, completely ruining this card due to its activation condition?? Hmm....

No, the court has no such effect and even if it did it wouldn't matter since - in this case - the Field's destruction wouldn't be caused by a card effect but by a game mechanic. Nowhere on the Field Spell does it say "destroy the other field"; that's a ruling and thus impervious to negation. The only thing that blocks a new field is a card in lieu of ACC's crazy field that prevents other field spells from being activated or some negation or destruction trap or Quick-Play that keeps the new field from resolving in the first place.

Quote:

Originally Posted by Ichaste Pekoni (Post 3072233)
...4-star, please? I don't think we can have a 2200-ATK (after selecting a Monarch) beatstick that's immune to Gravity Bind & LLAB running around...

Copycat is 2400 after copying monarch and still 1 star and the gambler needs to average a three on the rolls just to outperform Jerry Beans Man. I really see no need to take away what little advantage they have. O=

Quote:

Originally Posted by Ichaste Pekoni (Post 3072233)
...Where're the Blitzes? =O

Planning to implement those in Limit Break style, actually. :3

Quote:

Originally Posted by Ichaste Pekoni (Post 3072233)
Ring of Magnetism + Wandering Mimic + random beatstick/wall (A GIANT ROCK!!!!) = lock.

More like Marshmallon. ;3 Anyways, it's a lock with plenty of holes since wiping out either of the monsters or the ring nullifies it. Decoyroid + Heart of Clear Water does it with one card less, as does dual Marauding Captain or Solar Flare Dragon. Those aren't in either. O=

Quote:

Originally Posted by Ichaste Pekoni (Post 3072233)
>_> For a monster that gets run over by Cyber Dragon, the least you could do would be add it straight to the hand.

That was the original effect. But then I thought, what if you just keep swiping Phoenix Wing Wind Blast over and over again? Lock ftw. xP But fine, I'll restore it to original.

Quote:

Originally Posted by Ichaste Pekoni (Post 3072233)
So, does that include effects that activate on Battle Damage inflicted, like Kycoo's?

Yeah, as long as it's a one-shot effect it's fair game. :3


Anyways, I've added a 1000-life point price tag to the circle and made it affect both players. Better? :3 Oh, and Runic is now playing eradicator epidemic with your opponent. Less watered down now?


As for Kefka...well, I'm just really stumped as to what kind of effect I'd give him (Other than 'you may laugh at your opponent like a lunatic'). Plus, he's not one of the heroes, so yeah. I'm open to suggestions, though. ^.^


On the yokais...whoa, if these two are any indication these will be laughing at Skill Drain (and exploiting it like heck) since they resolve in the graveyard. Mmmhmm...I'll be interested to see the full scope of the set.

Yokai Mountain: the real term is 'Atk' rather than 'Attack', but w/e. Fair enough and probably a central piece for this new decktype. The loss of Main Phase 2 as payment is an interesting penalty. :3

Yoko Yokai: decent bulk, clocking in at a respectable 1900 when backed by the mountain, but you'll probably need some top-of-the-deck bounce like Phoenix Wing Wind Blast to make use of its tribute effect. Essentially, it's a pre-emptive Misfortune that doesn't cost you a Battle Phase.


And Scythe-kun...you've got serious wording issues, yes you do, to the point where the meaning of your effects becomes seriously obscured. Please take a look at some of the actual cards (or the plethora of fakes here) for the correct wordings. When Special Summoning (Not sending out; special summoning) you always need to specify where you summon from (Hand, Deck, Graveyard, or removed from play cards?). I'm also not in the clear about whether you wanted Moustalons and Ratamite to be summoned only through the effects of their lower links or if you just wanted to block other forms of special summoning (Huge difference in playability there). So like, say it in a language we can understand, yes? :3

Mousketeer: "When this card has been in Attack Position for three turns or more you may tribute this card to Special Summon one "Moustalons" from your Hand or Deck.". Useless, in a format where the average lifespan of a card on the field (even one with good stats) is one turn, there's no way something this wimpy could survive three and the thing it summons isn't anything to call home about either so it's not worth the investment it takes to keep it alive. Just...way too weak and too slow to pull off its effect. Too weak effect too. :\

Moustalons: "This card can not be Normal Summoned or Set. This card can only be Special Summoned by the effect of 'Mousketeer'. When this card has been in Defense Position for three turns or more, you may tribute this card to Special Summon one "Ratamite" from your Hand or Deck.". Ooohkay...something with a summon this specific seriously needs to be a lot stronger. As I said, the musketeer is a terrible card to play and this is even worse since it's completely worthless if you draw it. Again, expecting this to survive three turns is absurd.

Ratamite: "This card can not be Normal Summoned or Set. This card can only be Special Summoned by the effect of 'Moustalons'. During your Main Phase, you may pay 500 Life Points. If you do, this card can attack twice during the Battle Phase of this turn." So essentially a crazily strong double attacker (with a basically negligible cost). On its own, this would be broken, as it is it's not worth playing because there's no way you'll get it out. -.-

Overall, this trio could use some serious balancing. Power up Mousketeer and Moustalons and nerf Ratamite in exchange.


Anyways, a bit more for the FF VI crew:


Limit Break - Empowerer
Normal Spell

This card can only be activated by removing two cards in your Hand from play and selecting a face-up "Wandering Knight" on your Field. When the selected monster battles this turn, reduce the Atk of the monster it battles with by half then increase the Atk of the selected "Wandering Knight" by the same amount until the end of the turn. If the selected "Wandering Knight" inflicts Battle Damage to your opponent on the turn this effect is activated, increase your Life Points by the amount of damage inflicted. You may only activate one "Limit Break" Spell Card each turn. If "Wandering Knight" is the only monster on your Field, you do not need to remove any cards in your Hand from play to activate this card.

Limit Break - Morph
Normal Spell

This card can only be activated by paying half your Life Points and selecting a face-up "Wandering Witch" on your Field and a Spell Card other than a Continuous, Field, Equip or "Limit Break" Spell Card in your Graveyard. Until your second Standby Phase after this card's activation, whenever the selected monster destroys a monster by battle, activate the effect of the Spell Card you selected. You may only activate one "Limit Break" Spell Card each turn. If "Wandering Witch" is the only monster on your Field, you do not need to pay any Life Points to activate this card.

Limit Break - Pummel
Normal Spell

This card can only be activated by paying half your Life Points and selecting a face-up "Wandering Fighter" on your Field. Increase the Atk of the selected monster by 500 until the end of the turn. On the turn this effect is activated, When the selected monster battles with a lower Atk monster, Damage Calculation is applied three times instead of one. You may only activate one "Limit Break" Spell Card each turn. If "Wandering Fighter" is the only monster on your Field, you do not need to pay any Life Points to activate this card.

Limit Break - Revitalize
Normal Spell

This card can only be activated by paying half your Life Points and selecting a face-up "Wandering Fighter" on your Field. Tribute the selected monster then select a "Wandering" monster from your Graveyard and Special Summon it to your Field. You may only activate one "Limit Break" Spell Card each turn. If "Wandering Fighter" is the only monster on your Field, you do not need to pay any Life Points to activate this card.

Limit Break - Snowman Jazz
Normal Spell

This card can only be activated by paying half your Life Points while "Wandering Moogle" is face-up on your Field. Until your next Standby Phase, your opponent may not set or activate any Spell or Trap Cards. You may only activate one "Limit Break" Spell Card each turn. If "Wandering Moogle" is the only monster on your Field, you do not need to pay any Life Points to activate this card.

Blizzard Orb
Equip Spell

This card can only be equipped to "Wandering Sasquatch". Increase the Atk of the monster equipped with this card by 600. When the equipped monster attacks, select up to two cards on your opponent's Field. Until your next Standby Phase after this effect was activated, your opponent may not activate any effects of the selected card(s).


Yeah, 'cause Umaro doesn't have a limit or special ability I figured I'd throw in one of the two items he can actually use instead. xD And...I had an idea for a set I wanted to make a while ago, but now I've gone and forgotten it. Oh well, later I suppose. :3 One card that does come to mind, however:

Winged Euphoria
Fairy/Effect
8 Star/Light
2600 Atk / 2300 Def

Whenever a card effect that would inflict damage to this card's controller is activated, all damage from the effect to the controller of this card is negated. Then, the controller of this card gains Life Points equal to the amount of damage he/she would have received.

And yes, there is a card that exploits this effect like crazy. Cookie to the one who mentions it first. And as a ruling to resolve what would otherwise be an infinite loop between this and Simochi: the one that places itself higher in the chain takes precedence, so if Euphoria tries to convert a burn card to damage while Simochi is out, Simochi takes precedence and turns it to burn, but if Simochi tries to convert an LP gain effect other than Euphoria's then Euphoria takes precedence and it stays as LP gain. :3

Scarlet Weather November 12th, 2007 5:46 AM

The main phase two cost is basically to prevent ability abuse, since Yokai only get to pull their little tricks during the main phase. Pulling tricks twice in a row would be a bit... evil, even if it's one turn apart.

Karasu Yokai
Monster/Dark/Winged Beast/Effect/4*
Atk 1400/ Def 1300
During your main phase, tribute this monster in order to randomly select one card from your opponent's hand and place it on the bottom of their deck. This effect may not be activated if your opponent has fewer then three cards in their hand.

Kappa Yokai
Monster/Water/Fish/Effect/4*
Atk 1500/ Def 1500
During your main phase you may tribute this monster in order to summon a level five or lower "Yokai" monster from your deck. A monster summoned in this way cannot be tributed on the turn it was summoned.

Oni Yokai
Monster/Earth/Fiend/Effect/6*
Atk 1900/ Def 0000
During your main phase, you may tribute this monster in order to look at the bottom card of an opponent's deck. Depending on the card type, activate the appropriate effect:
-Spell: Destroy one monster your opponent controls.
-Trap: Add one "Yokai Mountain" from your deck or graveyard to your hand.
-Monster: If this monster is special summoned from the graveyard during your next turn, its original Atk becomes 2500.

Yokai Bakudan
Monster/Fire/Fairy/Effect/5*
Atk 1000/ Def 0000
During your main phase, you may tribute this face-up monster in order to destroy one five-star or higher monster your opponent controls and inflict damage to them equal to half the attack points of the destroyed monster. You may not conduct your battle phase on the turn you activate this effect.

King of Yokai
Monster/Fire/Beast/Effect/8*
Atk 2700/ Def 2000
This monster cannot be special summoned. During your main phase, tribute this monster in order to special summon a number of "Yokai" monsters from your graveyard equal to the number of cards in your opponent's hand OR the number of monsters on their field.

Inu Yokai
Monster/Beast/Wind/Effect/4*
Atk 1500/ Def 0000
During your main phase, tribute this monster in order to destroy spell or trap cards on the opponent's side of the field equal to the number of monsters on their side of the field OR the number of cards in their hand. This monster cannot activate its effect on the turn it was summoned.

Fog of the Demon Mountain
Normal Trap
If your opponent declares an attack on your life points while there is a "Yokai" monster in your graveyard, special summon one "Yokai" monster from your graveyard. That monster becomes the attack's new target. A monster summoned in this way is returned to your graveyard at the end of the turn.

Card of Self-Sacrifice
Continuous Spell
Each time you tribute a monster for its own effect, draw a card.

Scroll of the Yokai
Equip Spell
This card can only be equipped to a "Yokai" monster. Increase the attack of the equipped monster by three hundred points. When the equipped monster is tributed for its own effect, by removing this card in the graveyard from play you may special summon one "Yokai" monster from your deck with the same or fewer level stars then the tributed monster.

Scytheteen November 12th, 2007 8:35 AM

Quote:

Originally Posted by Alter Ego (Post 3073730)


And Scythe-kun...you've got serious wording issues, yes you do, to the point where the meaning of your effects becomes seriously obscured. Please take a look at some of the actual cards (or the plethora of fakes here) for the correct wordings. When Special Summoning (Not sending out; special summoning) you always need to specify where you summon from (Hand, Deck, Graveyard, or removed from play cards?). I'm also not in the clear about whether you wanted Moustalons and Ratamite to be summoned only through the effects of their lower links or if you just wanted to block other forms of special summoning (Huge difference in playability there). So like, say it in a language we can understand, yes? :3

Mousketeer: "When this card has been in Attack Position for three turns or more you may tribute this card to Special Summon one "Moustalons" from your Hand or Deck.". Useless, in a format where the average lifespan of a card on the field (even one with good stats) is one turn, there's no way something this wimpy could survive three and the thing it summons isn't anything to call home about either so it's not worth the investment it takes to keep it alive. Just...way too weak and too slow to pull off its effect. Too weak effect too. :\

Moustalons: "This card can not be Normal Summoned or Set. This card can only be Special Summoned by the effect of 'Mousketeer'. When this card has been in Defense Position for three turns or more, you may tribute this card to Special Summon one "Ratamite" from your Hand or Deck.". Ooohkay...something with a summon this specific seriously needs to be a lot stronger. As I said, the musketeer is a terrible card to play and this is even worse since it's completely worthless if you draw it. Again, expecting this to survive three turns is absurd.

Ratamite: "This card can not be Normal Summoned or Set. This card can only be Special Summoned by the effect of 'Moustalons'. During your Main Phase, you may pay 500 Life Points. If you do, this card can attack twice during the Battle Phase of this turn." So essentially a crazily strong double attacker (with a basically negligible cost). On its own, this would be broken, as it is it's not worth playing because there's no way you'll get it out. -.-

Overall, this trio could use some serious balancing. Power up Mousketeer and Moustalons and nerf Ratamite in exchange.



I'm sorry. I haven't done anything Yu-Gi-Oh related in at least a year. I'll go crawl under a rock now...

Alter Ego November 12th, 2007 9:07 AM

Quote:

Originally Posted by ScytheMaster (Post 3074353)
I'm sorry. I haven't done anything Yu-Gi-Oh related in at least a year. I'll go crawl under a rock now...

Now why would you want to do that? It's not like this isn't something a few edits can't fix; just check the official material if you're rusty. Oh, and sorry it came off so negative. I didn't meant to bash. .__.


Karasu Yokai: okay, I'm seeing some heavy-duty exploit in this. Just keep spamming this with the mountain and you'll essentially do what Icha's latest deck tries to do except better since there's no effect that triggers from the bottom of the deck. I'd say limit the effect so that you can only use it if your opponent has at least three or four cards in their hand. :3

Kappa Yokai: King of Yokai is just too easy to get out with this, really. I'd say restrict this to low-level Yokai instead (or possibly five-star and down).

Oni Yokai: the spell effect isn't doing anything at the moment since Yokai effects demand a tribute (as opposed to just being sent to the graveyard). And let's face it: this would be a bit too cheap with the intended effect. Screw the summons; just play this and shoot straight for the effect. (King of Yokai, anyone?)

Yokai Bakudan: so sort of like a weaker Ring of Destruction. One point, though: with the current wording you are forced to tribute Bakudan each turn regardless of conditions. Is this intentional? Well, fair enough card either way.

King of Yokai: lawl, why not just say "you can summon this monster without tribute"? I mean, what crazy yokai player wouldn't want to use those tribute effects each turn? xD In all seriousness, the effect is way too strong for something that's so easy to get into play. Make those lazy players tribute for this, I say. Considering the power of those other yokai monsters this is a very viable game ender and with the way things are right now you can do an absolutely crazy loop by tributing Kappa to pull this then tributing this to pull Kappa and whatever else you have tucked away in your graveyard. Then lather, rinse and repeat each turn with Card of Safe Return on your side to net you a crazy amount of draws. You really need to break this loop at some point. I'd say remove the 'on the turn this card is summoned' limit and the ability that lets this be summoned without tribute and ban special summons. The explosive potential of this card would still be crazy.

Inu Yokai: because the other yokais aren't strong enough, they now have their very own Stratos-style field wiper too, except it's better because you don't have to bother with assembling a bunch of specific monsters on your own field.

Fog of the Demon Mountain: and now their only drawback is patched up too. Yokai Mountain not summoning enough for you? xD At least my Wildkin monsters go back into the deck so Ferocius Retaliation is only a single attack fix, but this is permanent field boost and makes yokai even quicker at recycling their effects than before.

Card of Self-Sacrifice: Strike my above statement on the loop, now it's two free draws; one for tributing the yokai and another when Yokai Mountain brings it back. You do realize that this translates to your average yokai player drawing 3+ cards per turn, right? Seriously, these things are drawing faster than Perfect Circle. @[email protected]

Scroll of the Yokai: basically reserved for the higher level ones since the low-levels don't have anything to summon, all of them being 4-star. Yet another way to pull Kappa, I suppose.


Ehh...I think you need to balance the effects on these. With Yokai Mountain out, these become virtually unstoppable, and thanks to Card of Self-Sacrifice finding that mountain probably won't be too hard either. I love the concept, but these current effects are just too easy to exploit.

Forci Stikane November 12th, 2007 9:17 AM

Quote:

Originally Posted by Alter Ego (Post 3073730)
No, the court has no such effect and even if it did it wouldn't matter since - in this case - the Field's destruction wouldn't be caused by a card effect but by a game mechanic. Nowhere on the Field Spell does it say "destroy the other field"; that's a ruling and thus impervious to negation. The only thing that blocks a new field is a card in lieu of ACC's crazy field that prevents other field spells from being activated or some negation or destruction trap or Quick-Play that keeps the new field from resolving in the first place.

No, I thought that one of the Royals had that effect...eh, doesn't matter anyway.

Yeah, as long as it's a one-shot effect it's fair game. :3

Well, then, *points at Victory Dragon's effect* SUPER-SPECIAL-AWESOME-SITUATIONAL-GGNORE.


As for Kefka...well, I'm just really stumped as to what kind of effect I'd give him (Other than 'you may laugh at your opponent like a lunatic'). Plus, he's not one of the heroes, so yeah. I'm open to suggestions, though. ^.^

Um...either monster control or Direct Attacks. I do suppose that "Wandering Crazy Clown" wouldn't work too well, though...XD


Anyways, a bit more for the FF VI crew:


Limit Break - Empowerer
Normal Spell

This card can only be activated by removing two cards in your Hand from play and selecting a face-up "Wandering Knight" on your Field. When the selected monster battles this turn, reduce the Atk of the monster it battles with by half then increase the Atk of the selected "Wandering Knight" by the same amount until the end of the turn. If the selected "Wandering Knight" inflicts Battle Damage to your opponent on the turn this effect is activated, increase your Life Points by the amount of damage inflicted. You may only activate one "Limit Break" Spell Card each turn. If "Wandering Knight" is the only monster on your Field, you do not need to remove any cards in your Hand from play to activate this card.

...Not bad.

Limit Break - Morph
Normal Spell

This card can only be activated by paying half your Life Points and selecting a face-up "Wandering Witch" on your Field and a Spell Card other than a Continuous, Field, Equip or "Limit Break" Spell Card in your Graveyard. Until your second Standby Phase after this card's activation, whenever the selected monster destroys a monster by battle, activate the effect of the Spell Card you selected. You may only activate one "Limit Break" Spell Card each turn. If "Wandering Witch" is the only monster on your Field, you do not need to pay any Life Points to activate this card.

If cost doesn't come into play, then Lightning Vortex & Heavy Storm will be your main targets. ......Not too sure that effect works very well with Terra, though............I would have expected something more related with her familial history. ;)

Limit Break - Pummel
Normal Spell

This card can only be activated by paying half your Life Points and selecting a face-up "Wandering Fighter" on your Field. Increase the Atk of the selected monster by 500 until the end of the turn. On the turn this effect is activated, When the selected monster battles with a lower Atk monster, Damage Calculation is applied three times instead of one. You may only activate one "Limit Break" Spell Card each turn. If "Wandering Fighter" is the only monster on your Field, you do not need to pay any Life Points to activate this card.

Ow. However...what about cases of FMC-style battling? If this thing attacked, say, a Defense-Position Goblin Attack Force with something like Big Bang Shot equipped, then what?

Limit Break - Revitalize
Normal Spell

This card can only be activated by paying half your Life Points and selecting a face-up "Wandering Fighter" on your Field. Tribute the selected monster then select a "Wandering" monster from your Graveyard and Special Summon it to your Field. You may only activate one "Limit Break" Spell Card each turn. If "Wandering Fighter" is the only monster on your Field, you do not need to pay any Life Points to activate this card.

Makes sense.

Limit Break - Snowman Jazz
Normal Spell

This card can only be activated by paying half your Life Points while "Wandering Moogle" is face-up on your Field. Until your next Standby Phase, your opponent may not set or activate any Spell or Trap Cards. You may only activate one "Limit Break" Spell Card each turn. If "Wandering Moogle" is the only monster on your Field, you do not need to pay any Life Points to activate this card.

Resembling Silence, right? That's fine.

Blizzard Orb
Equip Spell

This card can only be equipped to "Wandering Sasquatch". Increase the Atk of the monster equipped with this card by 600. When the equipped monster attacks, select up to two cards on your opponent's Field. Until your next Standby Phase after this effect was activated, your opponent may not activate any effects of the selected card(s).

...No comment here, partly since I never used Umaro that much >_>.

Yeah, 'cause Umaro doesn't have a limit or special ability I figured I'd throw in one of the two items he can actually use instead. xD And...I had an idea for a set I wanted to make a while ago, but now I've gone and forgotten it. Oh well, later I suppose. :3 One card that does come to mind, however:

Winged Euphoria
Fairy/Effect
8 Star/Light
2600 Atk / 2300 Def

Whenever a card effect that would inflict damage to this card's controller is activated, all damage from the effect to the controller of this card is negated. Then, the controller of this card gains Life Points equal to the amount of damage he/she would have received.

...So, we're either looking at Des Wombat negating the damage outright or this card changing it to LP gain......eh, I think I'd rather go with Wombat, since it can also go through the LLAB/GB that would be seen so often in dedicated burn decks.

And yes, there is a card that exploits this effect like crazy. Cookie to the one who mentions it first. And as a ruling to resolve what would otherwise be an infinite loop between this and Simochi: the one that places itself higher in the chain takes precedence, so if Euphoria tries to convert a burn card to damage while Simochi is out, Simochi takes precedence and turns it to burn, but if Simochi tries to convert an LP gain effect other than Euphoria's then Euphoria takes precedence and it stays as LP gain. :3

Dark Snake Syndrome. Cookie, please!

Scarlet Weather November 12th, 2007 11:45 AM

Hmm... Yokai leaves the field empty after usage since Yokai Mountain's effect only activates on the following turn, and it's field-spell dependent but I see what you mean about balancing the effects here. I'll go change that. 0_o

Yokai Ronin
Monster/Light/Effect/Warrior/4*
Atk 1200/ Def 400
During your main phase, tribute this monster in order to send one card from your deck to the graveyard. If the selected card is a "Yokai" monster, you may special summon it during your next turn through the effect of "Yokai Mountain"

And for a short break...

Relentless Restriction
Continuos Trap
Each time your opponent draws during a phase other then their draw phase, inflict eight hundred points of direct damage to them.

Off to balance my Yokai monsters! (La-la-la-la-la....)

EDIT: Done balancing, mostly following AE's advice. Anyway, a few other cards now:

Decree of Yokai
Normal Spell
During your standby phase, choose one "Yokai" monster you control. The selected "Yokai" monster gains five hundred attack points, and cannot be destroyed by battle.

And because every set needs a thematic destruction engine....

Yokai Okami
Monster/Light/Beast/Effect/4*
Atk 1100/ Def 1300
During your main phase, you may tribute this face-up monster in order to destroy one monster your opponent controls. That monster may not be special summoned during your opponent's next turn.

Exiled force? Your new replacement is here.... xD

Alter Ego November 13th, 2007 8:15 AM

Bleah, stupid cold killing my writing creativity. Guess it's children's playing cards for me for now. :3

Quote:

Originally Posted by Ichaste Pekoni (Post 3074464)
Dark Snake Syndrome. Cookie, please!

Gee, what is it about cookies that makes people lunge at them? xD But yes, the card in question is indeed Dark Snake Syndrome. *hands cookie*

Quote:

Originally Posted by Ichaste Pekoni (Post 3074464)
If cost doesn't come into play, then Lightning Vortex & Heavy Storm will be your main targets. ......Not too sure that effect works very well with Terra, though............I would have expected something more related with her familial history. ;)

Trust me, I tried to come up with something like that but at the same time I wanted to stay true to the actual power of that ability (trumped up spellcasting) so I'm having some...compatibility issues. xD Ehh...might make a new one, we'll see.

Quote:

Originally Posted by Ichaste Pekoni (Post 3074464)
Ow. However...what about cases of FMC-style battling? If this thing attacked, say, a Defense-Position Goblin Attack Force with something like Big Bang Shot equipped, then what?

Unboosted GAF has lower Atk than Big Bang Pummel Wandering Fighter so the opponent would be in for some serious pain. xD

Yokai Ronin: reverse toolbox style recruiter, eh? Pretty neat, though obviously field dependent. :3

Relentless Restriction: only your opponent? Major abuse alert; run three of these (backed by a set of Dark Bribe cards) and your opponent will be seriously screwed unless they get Jinzo or Decree out fast. I'd say make it burn both for the greater balance.

Decree of Yokai: permanent Marshamllonness + 500 Atk boost without the usual equip weakness? o.o Uhh...you might want to reconsider this one a little; at least put a duration limit on it. Sort of contradictory to the yokai self-sacrifice theme.

Yokai Okami: come now, you've already got Bakudon for destruction. Now the poor thing is crying over its replacedness in the shaded corner over yonder; I hope you're proud of yourself. :< Seriously, I'd say work with Bakudon instead; it's doing something that Exiled isn't and is thus a far cooler monster destruction engine because of its originality.

Oh, and the revamps are fine (Like I could say anything else xD) but Ino Yokai is still essentially a recyclable Harpie's Feather Duster. Why not make that like one or two cards and remove the activation limit? Or at least make it blast cards from both fields so you have to be more careful about using its effect?

Anyway, I guess I might as well give VI one last wanderer:

Wandering Madman
Spellcaster/Effect
8 Star/Dark
2800 Atk / 2500 Def

This card can not be Special Summoned. If this card was Tribute Summoned using two differently named "Wandering" monsters, it gains the following effect:

- Once per turn, discard one Spell Card in order to select a face-up monster on your opponent's Field and control it until the end of the turn this effect is activated. A monster controlled by this effect can not be offered as tribute and may attack your opponent directly. This card can not attack on the turn this effect is activated.

Direct attacks and monster control in one package. xD Might as well give him a partner too:

Limit Break - Light of Punishment
Normal Spell

This card can only be activated by paying half your Life Points while "Wandering Madman" is face-up on your Field. Declare either Effect Monster or Normal Monster then check all cards on your opponent's Field and in his/her Hand (card effects are not activated) and send all monsters of the declared type to the Graveyard. If "Wandering Madman" is the only monster on your Field, you do not need to pay any Life Points to activate this effect. You may only activate one "Limit Break" Spell Card each turn.


And returning to some old cards of mind. First off, Euphoria's little cousin gets a revamp:

Winged Mirth
Fairy/Effect
1 Star/Light
300 Atk / 200 Def

When you would receive damage other than as the result of Battle, discard this card from your Hand in order to reduce that damage to zero.


Aaand...an old set that didn't get enough love last time around. :3

Blaze Imp
Pyro/Effect
4 Star/Fire
1800 Atk / 300 Def

For each card that is removed from play while this card is removed from play, inflict 100 damage to your opponent.

Chthonian Flame Emperor
Pyro/Effect
5 Star/Fire
1800 Atk / 2300 Def

Whenever a card(s) is removed from play while this card is face-up on the Field, inflict 500 damage to your opponent.

Magma Golem
Rock/Effect
3 Star/Fire
800 Atk / 1600 Def

The type of this card is also treated as Pyro. When this card is summoned successfully (Including Flip Summon), you may remove from play up to three cards from the top of your Deck. For each card removed from play by this effect, increase the Atk of this card by 400 until the end of the turn this effect was activated. When this card is destroyed by Battle and sent to the Graveyard, you may remove it from play in order to draw a card.

Pyrohydra
Pyro/Effect
5 Star/Fire
? Atk / ? Def

When this card on your Field would be sent to the Graveyard, it is removed from play instead. Whenever five or more of your cards are removed from play at the same time, Special summon this removed from play card to your Field. The original Atk and Def of this card becomes the number of your cards removed from play x 400.

Sunset Phoenix
Winged Beast/Effect
7 Star/Fire
2400 Atk / 1700 Def

When you have two or more cards in your Hand other than this card, remove all cards in your Hand except this card from play in order to remove this card in your Hand or Graveyard from play. Whenever this card is removed from play by its own effect, Special Summon this card to the Field. Whenever this card is destroyed, select two Spell or Trap cards from the Field and destroy them. If this card is removed from play by an effect other than its own, shuffle it into your Deck.

Melting Mountain
Field Spell

Once per turn, during your Standby Phase, you may remove up to five cards from the top of your Deck from play in order to inflict damage to your opponent equal to 200 x the number of cards you removed. When a Pyro type monster on your Field would be destroyed, you may remove from play a number of cards from the top of your Deck equal to the level stars of that monster instead. (Damage Calculation, if any, is applied normally) When this card would be destroyed, you may remove a card in your Hand from play instead.

Volcano Buster
Normal Spell

When this card is removed from Play, inflict 1000 Damage to your opponent. Then, if this card was removed from your Hand or Deck, shuffle this card into your Deck.

Burning Veil
Continuous Spell

During each of your Standby Phases, remove one Pyro type monster from your Hand, Field, or Graveyard from play. If you do not, this card is destroyed. If your opponent declares an attack against a Pyro type monster on your Field while this card is face-up on the Field, all Battle Damage from that attack is inflicted to both players.

Pot of Iniquity
Normal Spell

Shuffle six of your cards removed from play into your Deck then draw two cards.

Magma Burst
Normal Trap

This card can only be activated on a Standby Phase when 10 or more of your card cards have been removed from play. Destroy all cards on the Field then skip your next Battle Phase.

Scarlet Weather November 13th, 2007 5:49 PM

Quote:

Originally Posted by Alter Ego (Post 3077878)
Bleah, stupid cold killing my writing creativity. Guess it's children's playing cards for me for now. :3



Gee, what is it about cookies that makes people lunge at them? xD But yes, the card in question is indeed Dark Snake Syndrome. *hands cookie*

Because cookies are the infinite winner.

Trust me, I tried to come up with something like that but at the same time I wanted to stay true to the actual power of that ability (trumped up spellcasting) so I'm having some...compatibility issues. xD Ehh...might make a new one, we'll see.

Can't comment, since I don't know much about Terra other then 'Main Character FTW!!!' with a spellcasting limit break.

Unboosted GAF has lower Atk than Big Bang Pummel Wandering Fighter so the opponent would be in for some serious pain. xD

Feel the power. XD

Yokai Ronin: reverse toolbox style recruiter, eh? Pretty neat, though obviously field dependent. :3

Well, all of the Yokai are dependent on the mountain to a greater or lesser degree. You'll be running the maximum number of Terraforming copies, and a field searcher most likely (I'll throw that one out in a moment). Anyway, glad you like him. ;3

Relentless Restriction: only your opponent? Major abuse alert; run three of these (backed by a set of Dark Bribe cards) and your opponent will be seriously screwed unless they get Jinzo or Decree out fast. I'd say make it burn both for the greater balance.

Unless your opponent doesn't draw. Point taken though... I'll take it up with my attorney. XD

Decree of Yokai: permanent Marshamllonness + 500 Atk boost without the usual equip weakness? o.o Uhh...you might want to reconsider this one a little; at least put a duration limit on it. Sort of contradictory to the yokai self-sacrifice theme.

It was only meant to last one turn, to give Yokai something to deal with Monarch. I'll make some changes.

Yokai Okami: come now, you've already got Bakudon for destruction. Now the poor thing is crying over its replacedness in the shaded corner over yonder; I hope you're proud of yourself. :< Seriously, I'd say work with Bakudon instead; it's doing something that Exiled isn't and is thus a far cooler monster destruction engine because of its originality.

Exiled doesn't prevent zombies from rezzing themselves. >.< Anyway, Bakudan is five-star so you basically have to make -2 CA to summon it without Kappa. 0_o Then again, I suppose Bakudan can always come back, so I guess it balances itself. I'll be transferring this monster into something a bit more palatable. XD

Oh, and the revamps are fine (Like I could say anything else xD) but Ino Yokai is still essentially a recyclable Harpie's Feather Duster. Why not make that like one or two cards and remove the activation limit? Or at least make it blast cards from both fields so you have to be more careful about using its effect?

I'll get right on that. I keep forgetting that you recycle these monsters. XD

Anyway, I guess I might as well give VI one last wanderer:

Wandering Madman
Spellcaster/Effect
8 Star/Dark
2800 Atk / 2500 Def

This card can not be Special Summoned. If this card was Tribute Summoned using two differently named "Wandering" monsters, it gains the following effect:

- Once per turn, discard one Spell Card in order to select a face-up monster on your opponent's Field and control it until the end of the turn this effect is activated. A monster controlled by this effect can not be offered as tribute and may attack your opponent directly. This card can not attack on the turn this effect is activated.

Direct attacks and monster control in one package. xD Might as well give him a partner too:

Limit Break - Light of Punishment
Normal Spell

This card can only be activated by paying half your Life Points while "Wandering Madman" is face-up on your Field. Declare either Effect Monster or Normal Monster then check all cards on your opponent's Field and in his/her Hand (card effects are not activated) and send all monsters of the declared type to the Graveyard. For each card sent to the Graveyard by this effect, inflict 500 damage to your opponent. If "Wandering Madman" is the only monster on your Field, you do not need to pay any Life Points to activate this effect. You may only activate one "Limit Break" Spell Card each turn.

And I thought I was the only one who could create beefed-up Wanderers. Actually, I think this one merits a required Wanderer tribute like Sephy, since you can basically turn your opponent's entire field against them. And the limit break... you may as well declare GG if your opponent doesn't have a guarding card in their backrow. Even then, your opponent's gonna be scooping if they don't draw a monster. If it weren't tied to a specific-summon monster, I'd be screaming "BROKEN! BROKEN!" I'd say 'tribute only by using two differently named 'Wandering' monsters.' That should take care of Limit Break abuse.

And returning to some old cards of mind. First off, Euphoria's little cousin gets a revamp:

Winged Mirth
Fairy/Effect
1 Star/Light
300 Atk / 200 Def

When you would receive damage other than as the result of Battle, discard this card from your Hand in order to reduce that damage to zero.

WMC burn now hates your guts, AE. XD

Aaand...an old set that didn't get enough love last time around. :3

Blaze Imp
Pyro/Effect
4 Star/Fire
1800 Atk / 300 Def

For each card that is removed from play while this card is removed from play, inflict 100 damage to your opponent.

Change that to 'when' if this was meant to be a one-off, or specify when the damage is dealt. Other then that, fair enough.

Chthonian Flame Emperor
Pyro/Effect
4 Star/Fire
1500 Atk / 1300 Def

Whenever a card(s) is removed from play while this card is face-up on the Field, inflict 500 damage to your opponent.

Okay, now we're starting to look into the realm of brokenness. This guy is UFO Turtle searchable, and when he's on the field, we're talking 3500 points of damage each turn with Melting Mountain. I'd say make him five-star, or unrecruitable. And at the very least, restrict his burn effect to cards removed from your field or hand, so MM abuse isn't going on.

Magma Golem
Rock/Effect
3 Star/Fire
800 Atk / 1600 Def

The type of this card is also treated as Pyro. When this card is summoned successfully (Including Flip Summon), you may remove from play up to three cards from the top of your Deck. For each card removed from play by this effect, increase the Atk of this card by 400 until the end of the turn this effect was activated. When this card is destroyed by Battle and sent to the Graveyard, you may remove it from play in order to draw a card.

I thought there was already a Magma Golem. Was that one a Lava Golem? I can never remember. Anyway, if not for CFE, this card would be quite fair. As is, you're tossing another 1500 at the opponent and basically making it a two-turn battle.

Pyrohydra
Pyro/Effect
5 Star/Fire
? Atk / ? Def

When this card would be sent to the Graveyard, it is removed from play instead. Whenever five or more of your cards are removed from play at the same time, Special summon this removed from play card to your Field. The original Atk and Def of this card becomes the number of your cards removed from play x 400.

Basically a way of keeping high-attack monsters at bay, huh? I like this one quite a bit, actually. My only regret is that it infinitely summons itself infinitely. I'd say you should only remove it when it gets hit during battle, because as is this thing is rather unkillable in combo with ONE use of melting mountain.

Sunset Phoenix
Winged Beast/Effect
7 Star/Fire
2400 Atk / 1700 Def

When you have two or more cards in your Hand other than this card, remove all cards in your Hand except this card from play in order to remove this card in your Hand or Graveyard from play. Whenever this card is removed from play by its own effect, Special Summon this card to the Field. Whenever this card is destroyed, select two Spell or Trap cards from the Field and destroy them. If this card is removed from play by an effect other than its own, shuffle it into your Deck.

Why don't you just say "special summon this monster from your hand or graveyard by removing all cards in your hand from play?" This monster is basically recyclable S/T hate, but the hand cost keeps it from brokenness.

Melting Mountain
Field Spell

Once per turn, during your Standby Phase, you may remove up to five cards from the top of your Deck from play in order to inflict damage to your opponent equal to 200 x the number of cards you removed. When a Pyro type monster on your Field would be destroyed, you may remove from play a number of cards from the top of your Deck equal to the level stars of that monster instead. (Damage Calculation, if any, is applied normally) When this card would be destroyed, you may remove a card in your Hand from play instead.

Once again: I'd say this is okay, except that this makes CFE basically the most broken monster on earth. 3500 damage per turn, plus another 2000 if my opponent attacks me? Yes please. Your opponent is gonna run out of life points way before you get outdecked, trust me.

Volcano Buster
Normal Spell

When this card is removed from Play, inflict 1000 Damage to your opponent. Then, if this card was removed from your Hand or Deck, shuffle this card into your Deck.

This card is a lot of fun, I'd say, and basically sums up the unbroken aspects of this set. Seriously, CFE killed it.

Burning Veil
Continuous Spell

During each of your Standby Phases, remove one Pyro type monster from your Hand, Field, or Graveyard from play. If you do not, this card is destroyed. If your opponent declares an attack against a Pyro type monster on your Field while this card is face-up on the Field, all Battle Damage from that attack is inflicted to both players.

I'd rather just use Melting Mountain, thank you.

Pot of Iniquity
Normal Spell

Shuffle six of your cards removed from play into your Deck then draw two cards.

And now you're taking even longer to outdeck while you use Chthonian Flame Emperor. Nah...

Magma Burst
Normal Trap

This card can only be activated on a Standby Phase when 10 or more of your card cards have been removed from play. Destroy all cards on the Field then skip your next Battle Phase.

So basically, two turns in this becomes CED without the burn effect? Actually, I'd rather keep Melting Mountain in play since my deck doesn't function well without it. I'd say that this is a good emergency escape route, though. xD

Revamped Yokai, and redistributed effects:

Yokai Okami
Monster/Water/Beast/Effect/4*
Atk 2100/ Def 0000
Destroy this monster if "Yokai Mountain" is not on the field. During your main phase, discard this card from your hand in order to add one "Yokai Mountain" from your graveyard or deck to your hand.

Inu Yokai
Monster/Wind/Beast/Effect/4*
Atk 1500/ Def 1500
During your main phase tribute this face up monster in order to destroy spell cards on you and your opponent's side of the field equal to the number of monsters on your respective fields or in your respective hands.

And for my next trick....

Sleight of Hand
Normal Spell
Draw one card. Switch all monsters you or your opponent controls into attack position (flip effects are not activated at this time.)

Hidden Spellbook
Equip Spell
When the equipped monster is sent to the graveyard by battle during your opponent's battle phase or as a result of a card effect your opponent controls, add one spell card from your deck to your hand.

Alter Ego November 14th, 2007 9:05 AM

Nyu, ACC...you seem to be overestimating the flame emperor. See how it says "Each time a card(s) is removed from play"? That means only 500 burn per effect, regardless of how many cards are removed. The emperor resolves once per effect so Emperor + full power mountain = 1500 burn, not 3500. (I agree that that would be crazy, which is why I gave that specific wording) Also, it only resolves once per chain so if - for instance - you chain something like D.D. Crow to your Melting Mountain (Don't ask me why someone would want to do that. xD) you'd still only get 500 burn out of it. Meh, I think I'll bump him out of the turtle range since he still combos so well with Melting Mountain's protection effect. xP

As for the imp: it's pulling a Marie except that it strikes from the removed from play pile rather than the graveyard, so every card that is removed from play while the imp is in your removed from play pile burns for 100. I can't say 'when' since that would only include the cards that are removed at the same time as this one. (Bleh, effects dealing with the removed from plays are such a pain to word xP) Basically, I intended for this to double up as muscle for to keep the field under control while we burn our way down to hydra or - if the imp gets removed - an accelerator for the burn. :3

Quote:

Originally Posted by ACC-M (Post 3079176)
Can't comment, since I don't know much about Terra other then 'Main Character FTW!!!' with a spellcasting limit break.

Well, it's not really a limit break, actually. You see, in FF VI there are only two limit breaks (Spin Edge for the ladies and Tiger Break for the guys, only the latter of which is any good) and they trigger automatically. However, each character has their own special ability so I've based their limit break spell cards on those. x3

As for Kefka's wandering counterpart...he's already no special summon and is nothing but a subpar vanilla unless you give up two different wanderers. =O But yeah, I removed the burn from his limit all the same. :3

Quote:

Originally Posted by ACC-M (Post 3079176)
thought there was already a Magma Golem. Was that one a Lava Golem? I can never remember. Anyway, if not for CFE, this card would be quite fair. As is, you're tossing another 1500 at the opponent and basically making it a two-turn battle.

It was lava, so there's no overlap, and the emperor has already been addressed, so... :3

Quote:

Originally Posted by ACC-M (Post 3079176)
Basically a way of keeping high-attack monsters at bay, huh? I like this one quite a bit, actually. My only regret is that it infinitely summons itself infinitely. I'd say you should only remove it when it gets hit during battle, because as is this thing is rather unkillable in combo with ONE use of melting mountain.

Umm...actually, the current effect means that it only summons itself when five or more cards get removed at the same time (When they get removed, not when they are in your removed from play pile), so you'd have to pull Melting Mountain's effect again and again to keep it in play if your opponent keeps pounding it down. Meh, I'll make it remove only if it's on the field first, but keep in mind that hydras are supposed to be hard to kill. ;D

Quote:

Originally Posted by ACC-M (Post 3079176)
Why don't you just say "special summon this monster from your hand or graveyard by removing all cards in your hand from play?" This monster is basically recyclable S/T hate, but the hand cost keeps it from brokenness.

There are subtle differences. First off, Soul Absorption gets one more card to enjoy through this. Second, this way it's not viable for Card of Safe Return exploit. Third, this way it's not special summoning from the hand or graveyard, which may become important with certain cards.

Quote:

Originally Posted by ACC-M (Post 3079176)
So basically, two turns in this becomes CED without the burn effect? Actually, I'd rather keep Melting Mountain in play since my deck doesn't function well without it. I'd say that this is a good emergency escape route, though. xD

It doesn't touch the hand so it's not a true CED. Also, you can keep your mountain, actually, because the mountain's self-protection can safeguard it for the cost of a card from your hand. ;D

Yokai Okami: uhh-huh, screw Terraforming; this is all the field search you'll ever need and then some. Tone-down, please, normal searchers can't touch you graveyard and don't double up as protection. Besides, Oni Yokai is already field searching; does it really need this guy as competition? D=

Inu Yokai: Okay, let me see if I got this effect straight. Is it like, both lose S/Ts equal to the number of the declared cards they have? Mhhmm...I think this has made the transition to Heavy Storm, which is definitely improvement. I see no issues here. ^^

Sleight of Hand: Instant three in decks that need to dig for specific cards because it's a costless self-replacer. Congratulations, you've just screwed Upstart Goblin over big time. Besides, I already made a card called Sleight of Hand like...ages ago. xD

Hidden Spellbook: another candidate for splashing because this makes digging up those key spells ridiculously easy. Just slap this on a recruiter and charge into your opponent's attack position beatstick. Some kind of balancing effect would be in order here. This would so get confused with Hidden Book of Spell. xD


Anyways, I'm sort of short on time right now so I'm only doing one fake:

Different Dimension Gardna

Fiend/Effect
3 Star/Light
300 Atk / 1700 Def

Only once per duel, when this card has been removed from play, you may negate the attack of a monster controlled by your opponent and remove it from play until the end of the Battle Phase.

Scarlet Weather November 15th, 2007 2:20 PM

Quote:

Originally Posted by Alter Ego (Post 3080233)
Nyu, ACC...you seem to be overestimating the flame emperor. See how it says "Each time a card(s) is removed from play"? That means only 500 burn per effect, regardless of how many cards are removed. The emperor resolves once per effect so Emperor + full power mountain = 1500 burn, not 3500. (I agree that that would be crazy, which is why I gave that specific wording) Also, it only resolves once per chain so if - for instance - you chain something like D.D. Crow to your Melting Mountain (Don't ask me why someone would want to do that. xD) you'd still only get 500 burn out of it. Meh, I think I'll bump him out of the turtle range since he still combos so well with Melting Mountain's protection effect. xP

Oops. 0_o

As for the imp: it's pulling a Marie except that it strikes from the removed from play pile rather than the graveyard, so every card that is removed from play while the imp is in your removed from play pile burns for 100. I can't say 'when' since that would only include the cards that are removed at the same time as this one. (Bleh, effects dealing with the removed from plays are such a pain to word xP) Basically, I intended for this to double up as muscle for to keep the field under control while we burn our way down to hydra or - if the imp gets removed - an accelerator for the burn. :3

Oh.... I see....

Well, it's not really a limit break, actually. You see, in FF VI there are only two limit breaks (Spin Edge for the ladies and Tiger Break for the guys, only the latter of which is any good) and they trigger automatically. However, each character has their own special ability so I've based their limit break spell cards on those. x3

Once again, ignorance betrays me. :0

As for Kefka's wandering counterpart...he's already no special summon and is nothing but a subpar vanilla unless you give up two different wanderers. =O But yeah, I removed the burn from his limit all the same. :3

Missed the part about specifics, but yeah, the burn was going a little too far. Especially since as I recall it overshadowed Angel Nova. We all know that NOBODY is allowed to overshadow Sephiroth.

It was lava, so there's no overlap, and the emperor has already been addressed, so... :3

I see. Of course, the randomness of giving it a rock typing doesn't really need to be present. It's more card-thematic than an effect that'll be called into play in a given duel.

Umm...actually, the current effect means that it only summons itself when five or more cards get removed at the same time (When they get removed, not when they are in your removed from play pile), so you'd have to pull Melting Mountain's effect again and again to keep it in play if your opponent keeps pounding it down. Meh, I'll make it remove only if it's on the field first, but keep in mind that hydras are supposed to be hard to kill. ;D

Hmm... I'd say clarify the wording a bit in that case. Who knows how many other people will make my mistake? How about just saying "When five or more cards are removed from play at the same time by a card effect..."

There are subtle differences. First off, Soul Absorption gets one more card to enjoy through this. Second, this way it's not viable for Card of Safe Return exploit. Third, this way it's not special summoning from the hand or graveyard, which may become important with certain cards.

Ah....

It doesn't touch the hand so it's not a true CED. Also, you can keep your mountain, actually, because the mountain's self-protection can safeguard it for the cost of a card from your hand. ;D

Forgot about CED's hand screwing capabilities. And this from the guy whose first real deck was Chaos. (Le Gasp)

Yokai Okami: uhh-huh, screw Terraforming; this is all the field search you'll ever need and then some. Tone-down, please, normal searchers can't touch you graveyard and don't double up as protection. Besides, Oni Yokai is already field searching; does it really need this guy as competition? D=

Oni Yokai requires way more setup then most field searches, and your ability to activate his effect is directly dependent on what Karasu tossed during your last use of him. Point taken though, especially considering that Okami ties with Monarch with stat boost. I'll try holding back the effect a bit there.

Inu Yokai: Okay, let me see if I got this effect straight. Is it like, both lose S/Ts equal to the number of the declared cards they have? Mhhmm...I think this has made the transition to Heavy Storm, which is definitely improvement. I see no issues here. ^^

You hit the nail on the head.

Sleight of Hand: Instant three in decks that need to dig for specific cards because it's a costless self-replacer. Congratulations, you've just screwed Upstart Goblin over big time. Besides, I already made a card called Sleight of Hand like...ages ago. xD

You were just using your second sight to predict that I would make one. Yeh, good point there. I forget, is it Upstart Goblin that got limited or was that Good Goblin Housekeeping?

Hidden Spellbook: another candidate for splashing because this makes digging up those key spells ridiculously easy. Just slap this on a recruiter and charge into your opponent's attack position beatstick. Some kind of balancing effect would be in order here. This would so get confused with Hidden Book of Spell. xD

Did I put battle in there? Dang, I'm starting to break my cards in ways I never originally intended. 0_o That was meant to be only card effect destruction. Oopsies...

Anyways, I'm sort of short on time right now so I'm only doing one fake:

Different Dimension Gardna

Fiend/Effect
3 Star/Light
300 Atk / 1700 Def

Only once per duel, when this card has been removed from play, negate the attack of a monster controlled by your opponent and remove it from play until the end of the Battle Phase.

So basically extra fodder for MM burn, right? Remove from play with Melting Mountain, and this guy then turns into a selective negate attack. Not bad, not bad at all. Of course, he's pretty much useless if you draw him except as a temporary shield, but I suppose that's OK. I suppose the removal from the field is to make sure the monster doesn't just declare another attack through replay?

Haseo, the Sliver Twilight November 15th, 2007 3:55 PM

Hmmm... I make random decks based off stuff for people's fanfics sometimes. Should I put any here?

Scarlet Weather November 15th, 2007 8:26 PM

@Haseo: If the cards in the deck are your own invention, then yes, post away.

Anyway, I've edited Okami so it only does the standard field search from deck. In addition, Hidden Spellbook still nets a spell card when your monster gets killed as a result of battle, but now it has to be during your opponent's battle phase. I know, now we're looking at semi-limited I'd guess, but I'd guess this is basically slated to be a "paralysis" card like Sasuke Samurai #4.

Anyway, moving on...

Hymn of the Fayth
Quickplay Spell
Discard one "Wandering Aeon" monster from your hand. Increase the Atk of a "Wandering" monster on your side of the field by half of the discarded monster's Atk points.

And some edited FFX Wanderers:

Wandering Guardian
Monster/Dark/Warrior/Effect/6*
Atk 2400/Def 2000
When this monster destroys a monster in defense position, subtract the difference in this monsters's Atk points and the defending monster's defense points from your opponent's life points. When this monster is summoned by tributing a "Wandering" monster and "Wandering Summoner" or "Wandering Healer" is face-up on your field, you may reduce the original attack or defense of one monster on your opponent's side of the field by half.

Wandering Blitzer
Monster/Water/Warrior/Effect/5*
Atk 1600/ Def 1400
When another face-up "Wandering" monster is on your side of the field when this monster is tribute summoned, select and activate one of the following effects:
-Your opponent cannot activate spell cards during their next main phase.
-Your opponent must flip a coin when attacking a "Wandering" monster on your side of the field. If the coin is tails, your opponent may not attack that "Wandering" monster this turn.
-Your opponent cannot activate trap cards until their next battle phase.

And the limit breaks...

Limit Break-Banishing Blade
Normal Spell
Pay half your life points and select one face-up "Wandering Guardian" on your side of the field. When the selected "Wandering Guardian" declares an attack this turn, reduce the original attack and defense of all face-up monsters on your opponent's side of the field by half. If "Wandering Guardian" is the only monster on your side of the field, you do not need to pay life points to activate this card. You may only activate one "Limit Break" spell per turn.

Limit Break-Attack Reels
Normal Spell
Pay half your life points and select one "Wandering Blitzer" on your side of the field. The selected "Wandering Blitzer" gains five hundred attack points until the end of the turn. Then flip one coin for each monster on your opponent's side of the field and one coin for your opponent. The selected "Wandering Blitzer" may attack each monster for which the coin landed heads. In addition to its normal attack, if the coin for your opponent is heads, the selected "Wandering Blitzer" may attack your opponent's life points directly. If "Wandering Blitzer" is the only monster on your side of the field, you do not need to pay life points to activate this card. You may only activate one "Limit Break" spell per turn.

Alter Ego November 16th, 2007 2:55 AM

Mmmhmm...I'm pretty sure that both of the goblin cards have spent their time on the semi-limited side due to Exodia and the like, but Housekeeping is the regular semi-limited since three chained copies finished off with Emergency Provisions results in a combined effect of "Gain 3000 Life Points, draw 12 cards, then return 3 cards from your Hand to the bottom of your Deck". Needless to say, that's a lucrative prospect that puts the old Mirage/Provisions combo to shame in terms of sheer replenishing and deck cycling power.

Aaand...I'll see about getting a clearer wording for the hydra. As for Gardna; well, there would be no replay since it's not summoning anything to your field, but this way it blocks multi-attackers, nets another go for CFE and Soul Absorption and does some fun stuff with permanent effect monsters like Jinzo and Command Knight. (Come to think of it, it's especially mean to Sunset Phoenix since the poor thing gets tossed back into the deck by its own effect) Besides, removing from play ties in with the D.D. thematic. ;D

Anyways...

Hymn of the Fayth: so..basically a way to beef up the wanderers? Seeing as how this wording makes the boost permanent, this might well be worth the investment.

Wandering Guardian: umm...if we're conducting damage calculation as if the target was in attack position then modifying the Def won't matter since we're going by Atk anyway. Interesting effects, but remove one of the two parts from the first effect to prevent them for circumventing each other.

Wandering Blitzer: No-one in their right mind would go for the attack negation. Seeing as how it's only one monster, I think you could extend it to no attacks for two battle phases without a coin flip. Not much muscle to bring, but because of its paralytic ability this still has its uses, I think. But you know...you could lift the ban on special summons and just make it so that it doesn't get its effect unless it's tribute summoned (monarch style ftw). x3 I think you could also safely raise the stats a bit. (maybe like 1800-1900 range in Atk)

Limit Break-Banishing Blade: ouch, permanent Dark Dreadroute on everything your opponent has? x.O I'd say limit that to only the turn this effect is activated, or possibly until your next Standby Phase.

Limit Break-Attack Reels: gambling style limit, eh? Well, the permanent Atk boost sort of clashes with the limit break flair, but that aside, fair enough I suppose. One problem, though, using the current wording the blitzer would go chimeraish, that is: either attack the monsters or the player but not both. Adding an "in addition to its normal attack" and that problem should be solved. (After all, the current wording of that part just gives it direct attacking ability; not an extra attack)

Now for the revised ones:

Yokai Okami: Better, but I still think it's too large when you take the field boost into account. Considering how this is still more flexible than your average searcher I'd say make it something like 1800 or 1700 base Atk. Being able to butt heads with Jinzo and monarchs is certainly taking it too far. (incidentally; that 0 Def is a merit in many cases since it means that this thing is the last in line for Smashing Ground)

Hidden Spellbook: if we ignore the fact that your opponent has a 50/50 chance of getting away with attacking Samurai and can play monster removal with impunity. With this, you basically can't win as - at the very least - you'll have to give up a piece of S/T removal to get rid of the spell, making it a one-for-one unless it's Heavy Storm time; just imagine this on Sasuke Samurai #4. o.o I'd say make it either the battle destruction or effect destruction, because the only way I can see getting out of this is to Phoenix Wing or Raiza the equipped monster.


Unless...>D

Neo Cyber Dragon
Machine/Gemini
4 Star/Light
1800 Atk / 1300 Def

While this card is on your Field or in your Graveyard, it is treated as a Normal Monster. While this card is face-up on your Field, you may Normal Summon it in order to have it treated as an Effect Monster with the following effect:

- This card is treated as "Cyber Dragon".

Cyber Disruptor Dragon
Machine/Effect
7 Star/Light
2300 Atk / 2800 Def

This card can not be Special Summoned except by the effect of "Disruption Unit". Whenever a player activates the effect of a card from his/her Hand while this card is in face-up Attack Position, negate the activation and effect of that card and send it to the Graveyard, then reduce the original Atk of this card by 400. Whenever a player activates the effect of a card on his/her Field while this card is in face-up Defense Position, negate the activation and effect of that card and destroy it, then reduce the original Def of this card by 600. If the Atk or Def of this card is lower than the amount it would be reduced by, the effect(s) of this card can not be activated.

Disruption Unit
Quick-Play Spell

Tribute two "Cyber Dragon"s from your Field then Special Summon one "Cyber Disruptor Dragon" from your Hand, Deck, or Graveyard.


Yay for Light and Darkness Dragon rip-offs. xD Oh, and one card inspired by the latest development in CARD GAMES:

Hereditary Title
Normal Trap

This card can only be activated on the End Phase of a turn when a "Curran", "Pikeru" or "Royal" monster(s) on your Field was destroyed. Select one Effect Monster of a lower level than one of the destroyed monsters from your Hand or Deck and Special Summon it to your Field. A monster Special Summoned by this effect is treated as a "Royal" monster. Any effect(s) of the monster summoned by this effect that designate a monster(s) with a specific name are treated as designating "Royal" monsters and any effect(s) of the monster summoned by this effect that designate a specific Field Spell are treated as designating "Court of Nobles". In addition, any effect(s) of the monster Special Summoned by this effect that would be activated by Normal Summon or Flip Summon are activated when the monster is Special Summoned by this effect.

xD

Scarlet Weather November 16th, 2007 8:16 AM

Your card design is horrible, AE. Back to grade school with you. >.<

Disruptor Dragon: Kind of a more inclusive LaDD, huh? Except you can't spam Treeborn, since if memory serves right Treeborn's effect resolves in the graveyard. Question-would this thing hurt Yokai, since their effects resolve in the same manner?

Neo Cyber Dragon: Oh really now, didn't Cyber Dragon get enough love with the original cards? >.< Nevertheless, better then proto dragon.

Hereditary Title: Oh, I just can't wait to see you use this in CARD GAMES. Miseres+Court of Nobles FTW!!!! Of course, maybe you should say that any effects of the selected monster designating normal or flip summon are treated as designating special summon, since Miseres only resolves its effects through one of those two effects.

Alter Ego November 16th, 2007 8:38 AM

Good question that. Since Cyber Disruptor Dragon specifically attacks the activation of the effect (as opposed to the resolution, like Skill Drain does) I believe that Exiled and yokais would indeed be negated as they need to be on the field to activate. Treeborn and recruiters don't, so the little wretches get off the hook.

And I was actually looking for a way to make that second effect play out without creating a huge loophole for other monsters. Mmhmm...I think I'll go with your suggestion, though that makes pulling Guardian Sphinx with this a real blast. xD

Aaand Cyber Dragon is only really played for its own splashability and crazy fusions; the nomis got no love, so I'm aiming at them. D=

Which reminds me...

Cybernetic Evolution

Normal Spell

Tribute one "Cyber Dragon" from your Field and discard one Spell Card that designates "Cyber Dragon" in its card effect from your Hand or Deck in order to select one monster from your Hand, Deck or Graveyard other than "Cyber Dragon" that is designated in the card effect of the Spell Card you discarded and Special Summon it to your Field, ignoring summoning conditions.

^
Basically, a fancy way to say: summon your favorite Cyber Dragon nomi.

Chimeratech Debiliator Dragon
Machine/Effect
10 Star/Dark
? Atk / ? Def

Cyber Disruptor Dragon + any number of Machine Type monsters

When this card is Fusion Summoned successfully, destroy all other cards on your Field. The original Atk of this card becomes 600 x the number of monsters used in the Fusion Summon and the original Def of this card becomes 800 x the number of monsters used in the Fusion Summon. Whenever a player activates the effect of a card from his/her Hand, negate the activation and effect of that card and send it to the Graveyard, then reduce the original Atk of this card by 400. Whenever a player activates the effect of a card from his/her Field, negate the activation and effect of that card and destroy it, then reduce the original Def of this card by 600. If the Atk or Def of this card is lower than the amount it would be reduced by, the effect(s) of this card can not be activated and this card is destroyed. When this card is destroyed by its own effect, draw a card.


Inspired by a certain Chimeratech monster featured in the anime. Okay, I'm done with Cyber Dragons now. :3


And, I'm working on my CARD GAMES IC on the side here, in case you were wondering. xD

Eon-Rider November 16th, 2007 9:19 PM

I suck at rating cards but I just have to say that the text of Chimeratech Debiliator Dragon is way too long. :P

Scarlet Weather November 17th, 2007 8:24 PM

Multiple effects=long text. Do you know how you would go about changing this text to be shorter?

Lessee....

Wandering Dark Mage Girl
Monster/Dark/Spellcaster/Effect/6*
Atk 1900/ Def 1900
This monster cannot be special summoned. When this monster battles with a Fire, Water, or Light attribute monster, destroy that monster without applying damage calculation. By discarding one spell card from your hand while a "Wandering" monster is on the field, you may change this card's effect to one of the following.
-This monster's original attack becomes 2400.
-Destroy all Earth, Wind, and Dark attribute monsters that this card battles with without applying damage calculation.

Heh, Lulu is harder to convert because her purpose is basically to nuke Elemental fiends and deal heavy hits with Doublecast.

Wandering Machina Thief
Monster/Wind/Warrior/Effect/4*
Atk 1300/ Def 1300
Destroy any machine-type monsters that this monster battles with without applying damage calculation. When this monster destroys an opponent's monster as a result of battle, draw a card OR discard a card from your opponent's hand. (Your opponent chooses which effect is activated.)

Wandering Ronso
Monster/Earth/Beast-Warrior/Effect/6*
Atk 1700/Def 1500
This monster gains the effect of any monster on the field when it is summoned. If "Wandering Summoner" or "Wandering Healer" is face up on your side of the field, during your standby phase you may remove this monster from play. If you do so, special summon this monster during your next standby phase. When this monster is special summoned in this way, destroy one monster OR one face-up spell or trap card on your opponent's side of the field. This effect can only be used once for every copy of "Wandering Ronso" in your deck.

Wandering Aeon-Namia
Monster/Dark/Fiend/Effect/12*
Atk ????/Def ????
This monster can only be summoned through the effect of "Wandering Summoner". This monster's original attack and defense points are equal to the number of cards in both player's graveyards x300. This monster cannot be destroyed by monster, spell, or trap effects.

Heheh, would be broken if not for Summoner's little removal clause. (I hope...)

Limit Break time!

Limit Break-Fury
Normal Spell
Pay half your life points and select one face-up "Wandering Black Mage Girl" on your side of the field. Place up to fourteen cards from your deck face-down in front of you while your opponent times you (All cards used in this effect are returned to the deck after this card's effect has resolved.) Deal damage to your opponent equal to the number of cards you flip over in three seconds x400. If "Wandering Black Mage Girl" is the only monster on your side of the field you do not need to pay life points to activate this card. You may only activate one "Limit Break" spell card per turn.

I need to revise this one, but Fury is a hard break to translate. -_-

Limit Break-Ronso Rage
Normal Spell
Pay half your life points and select one "Wandering Ronso" on your side of the field. The selected "Wandering Ronso" gains the effect(s) of any monster on the field or in both player's graveyards for this turn only. The selected "Wandering Ronso" may activate any effects that require a successful normal summon or tribute summon as if they did not once during the turn this card is played. If "Wandering Ronso" is the only monster on your side of the field, you do not need to pay life points to activate this card. You may only activate one "Limit Break" spell per turn.

Limit Break-Oblivion
Normal Spell
Pay half your life points and select one "Wandering Aeon-Namia" on your side of the field. Destroy all face-up monsters on your opponent's side of the field. If "Wandering Summoner" and "Wandering Aeon-Namia" are the only monsters on your side of the field, you do not need to pay life points to activate this card. You may only activate one "Limit Break" spell card per turn.

Limit Break-Mix
Normal Spell
Pay half your life points and select one "Wandering Machina Thief" on your side of the field. Send two spell cards from your hand to the graveyard. If "Wandering Machina Thief" is the only monster on your side of the field, you do not need to pay life points to activate this card. You may only activate one "Limit Break" spell card per turn. If both spell cards discarded by this card's effect have one of the effects listed below, select and activate the appropriate effect:
-Destruction of monsters: Destroy two face-up monsters on the opponent's side of the field.
-Drawing from the deck/Removing cards from the hand: You and your opponent each draw four cards OR your opponent discards two cards from their hand.
-Destruction of spell or trap cards: Destroy spell cards on your opponent's side of the field equal to the number of cards in their hand OR the number of monsters on their field.
-Searching for cards in the deck: Select any card from your deck and add it to your hand.
-Any combination of the above listed effects or none of the above: The selected "Wandering Machina Thief" destroys any monster it battles with without applying damage calculation for this turn only.

Hmm... maybe a little overkill for that last one, but I suppose one of you could come up with something better to represent Mix, eh?

Alter Ego November 18th, 2007 2:33 AM

Wander Dark Mage Girl: one problem, since the effect specifies that the card's whole effect is changed, wouldn't that also override the effect changer effect? You might want to reword that somehow. x3 Other than that, fair enough.

Wandering Machina Thief: I think I'll stick with the rogue. Without some serious help it won't be destroying much beyond its machine destruction effect, which won't let the CA-generating effect activate. D=

Wandering Ronso: ahh...this would be the weird blue mage character of the game, yes? Fair enough, I suppose, though wouldn't that last provision imply that each Ronso can use its effect once plus once more for each other Ronso you have? (Meaning that each would get three shots if you have three in your deck) Maybe change that to something like "This card may only use this effect once per Duel.".

Wandering Aeon-Namia: I see no brokenness, really. It can still be blasted by higher Atk monsters and the buildup is very slow unless you have a seriously dedicated mill deck. (I mean, it needs more than half a deck's worth of cards to have been ditched just to pound down Cyber Dragon) Phoenix Wing and suchlike blow it off the field too. =O

Limit Break-Fury: heh, this effect is so wacky that I love it. In all fairness, though, I think the opponent should time it. Also, you need provisions for where the cards come from and where they go when you're done. Maybe restrict that to a maximum of 10 cards and 400 burn per card too? 4000 points of burn from a single card (provided that you can flip fast) is still pretty freakin' crazy, 7000 is completely out there. =O

Limit Break-Ronso Rage: ow, just ow. With Monarchs and Card Tropper all over the place, I shudder to think what this thing can do. x.O Anyway, to begin with you have to do something about those summon effects. Since they're 'on summon only' they don't have any restrictions on how many times they can be used, so that leaves room for major breaktacularity here. This still has some crazy exploit opportunities, though. Maybe restrict that to one 'on summon' effect to be at least sort of fair about it?

Limit Break-Oblivion: situational Lightning Vortex. Fine, why not? Heck, you could even extend it to all of your opponent's monsters in lieu with Burst Stream of Destruction.

Limit Break-Mix: broken to the max. (Come on, anything capable of drawing eight cards (or discarding four) at the cost of one, or pulling a no-wait Gold Sarcophagus in duplicate, is instantly broken) Just...tone down those abilities. A lot. xP The S/T removal one could be strengthened, though, since being able to destroy nothing but spell cards is pretty feeble.


Can we say crazy limit breaks? And you complained about Light of Punishment. x.O

Anyways, I think I've finally come up with some cards that would suit a certain NPC of mine. x3

True Power's Release
Normal Spell

Tribute one Level 2 or lower Normal Monster on your Field then Special Summon one "Unsealed" Fusion Monster of the same type as the tributed monster from your Fusion Deck. Send two level 2 or lower Normal Monsters from your Hand or Field to the Graveyard to add this card from your Graveyard to your Hand.

Gift of the Underdog
Normal Spell

Draw a number of cards equal to the number of Level 2 or lower Normal Monsters on your Field.

Power Limit
Continuous Spell

During each of your Standby Phases, pay 500 Life Points. If you do not, this card is destroyed. If a Level 4 or higher monster is summoned successfully (Including Flip Summon) while this card is face-up on the Field, reduce the Atk and Def of that monster by half until the end of the turn.

Unsealed Cat Fiend
Beast/Fusion/Effect
2 Star/Fire
800 Atk / 900 Def

This card only be Special Summoned by the effect of "True Power's Release". When this card is Special Summoned successfully, place 9 Life Counters on this card. Each time this card would be destroyed, remove one Life Counter from this card instead. (Damage Calculation, if any, is applied normally) If this card battles without a Life Counter, it is destroyed at the end of the Damage Step. Whenever this card attacks monster controlled by your opponent, destroy the attacked monster at the end of the Damage Step then inflict damage to your opponent equal to 100 x the level stars of the destroyed monster.

Unsealed Dragonette
Dragon/Fusion/Effect
2 Star/Wind
1400 Atk / 800 Def

This card can only be Special Summoned by the effect of "True Power's Release". Once per turn, you may select a number of cards from your opponent's Field up to the number of Level 2 or lower monsters on your Field and return them to their owner's Hand(s). On the turn this effect is activated, this card can not attack. When this card attacks or is attacked, by discarding one level 2 or lower Normal Monster from your Hand, return the monster this card battles with to its owner's Hand without applying Damage Calculation.

Unsealed Graveshuffler
Zombie/Fusion/Effect
2 Star/Dark
? Atk / ? Def

This card can only be Special Summoned by the effect of "True Power's Release". The Original Atk and Def of this card becomes the combined number of Level 2 or lower Normal Monsters in both players' Graveyards x 500. When this card is destroyed, add one Level 2 or lower Normal Monster from your Graveyard to your Hand.

Unsealed Hero
Warrior/Fusion/Effect
2 Star/Light
1200 Atk / 700 Def

This card can only be Special Summoned by the effect of "True Power's Release". This card can not be destroyed in Battle with a level 5 or higher monster. Once per turn, when this card attacks a monster on your opponent's Field, you may discard one card from your Hand. If you do, destroy the attacked monster with this card's effect without applying Damage Calculation. If the target monster is face-down, it is not flipped face-up by this effect.

Unsealed Hydra

Reptile/Effect
2 Star/Water
800 Atk / 1000 Def

When this card would be destroyed, you may destroy one Level 2 or lower Normal Monster on your Field instead. (A monster destroyed by this effect is treated as having been destroyed by Battle) For each Level 2 or lower monster on your Field, increase the original Atk of this card by 400. In addition to its normal attack, this card may attack a number of your opponent's monsters up to the number of Level 2 or lower Normal Monsters on your Field. On the turn this effect is activated, Level 2 or lower Normal Monsters on your Field may not attack.

Unsealed Illusionist
Spellcaster/Fusion/Effect
1 Star/Dark
800 Atk / 1200 Def

This card can only be Special Summoned by the effect of "True Power's Release". While there is another Level 2 or lower monster on your Field, this card can not be selected as an attack target. Once per turn, during your Main Phase, you may select one monster from either player's Graveyard and Special Summon it to your Field. Any Battle Damage inflicted by a monster Special Summoned by this effect becomes zero and when the monster battles, it is destroyed at the end of the Damage Step.

Unsealed Poltergeist
Fiend/Fusion/Effect
1 Star/Dark
700 Atk / 200 Def

This card can only be Special Summoned by the effect of "True Power's Release". During your Main Phase, you may tribute one Level 2 or lower monster on your Field. If you do, this card can attack your opponent directly this turn. Whenever this card inflicts Battle Damage to your opponent as the result of a Direct Attack, discard a number of cards from your opponent's Hand up to to the number of Level 2 or lower monsters on your Field.

Unsealed Soot Spirit
Pyro/Fusion/Effect
1 Star/Fire
500 Atk / 1700 Def

This card can only be Special Summoned by the effect of "True Power's Release". This card can not be destroyed by card effects. During each of your End Phases, if this card is face-up on the Field, you may Special Summon one Soot Token (Pyro Type/Earth Attribute/1 Star/0 Atk/0 Def) to your Field in Defense Position. Soot Tokens are treated as Normal Monsters. Also, while there is a face-up Soot Token(s) on your Field, your opponent may not declare an attack against any monster on your Field except Soot Token. (If there are multiple tokens, your opponent may choose which one to attack) During each of your Standby Phases, inflict 200 damage to your opponent for each Level 2 or lower Normal Monster on your Field.

Unsealed Storm Fiend
Thunder/Fusion/Effect
1 Star/Light
0 Atk / 1500 Def

This card can only be Special Summoned by the effect of "True Power's Release". This Attack Position card can not be destroyed by Battle. During each of your Standby Phases, if this card is face-up on the Field, select one card on your opponent's Field and destroy it. When this card battles, by discarding one level 2 or lower Normal Monster from your Hand, you may inflict all Battle Damage from that battle to your opponent.

Scarlet Weather November 19th, 2007 6:56 PM

Yay, I have Wi-fi out here so I can post!

Mix: You can only activate the effect once for both cards mixed, so you would only be able to draw four or discard two, not draw eight and discard four. You also have to have those cards in your deck in the first place in order to use Mix, and they have to be spells. Still, I'll revise to say that they must be in the hand, if that'll make you feel better.

Fury: Edited to suit your requests, but I'm keeping it at fourteen as you could be paying half your life points to deal this burn damage so there has to be SOME kind of huge payoff for the gamble you're taking.

Ronso Rage: Edited.

Wandering Ronso: Kimahri is also a Dragoon, hence the secondary effect. I'll edit later, as I'm short on time.

Unsealed: Interesting.... interesting. So, how do you plan to keep the normal monsters on the field long enough to draw into True Power's Release? Mist Body?

Frostweaver November 20th, 2007 7:11 PM

><; It's painful to review cards when there's like, "IT'S OVER 9000!!!" of them per post.


True Power Release- depends on the others... so

Gift of the Underdog- there's only one way to do this: we better pull off an Ojama swarm somehow...

Power Limit- more lv 3 weenie rush support, but too bad GBind and LLAB is still needed and they're rather missing... still, it only lasts on the turn they're summoned, so the Mad Lobster still got no hopes to run over the Cyber Dragon.

Unsealed Cat... Fiend- thou shall not mention the D word in a children's card game for adults. More reason to use ojama for this, as the closest other candidate is volcanic monsters... it's not a bad effect at all for stalling which is what Ojama is supposed to do. It can suicide ram itself and destroy plenty of cards at the cost of LP. It gives offensive Waboku another new meaning. Spirit Barrier (or whatever that trap was called, no LP damage if you have a monster) is the obvious choice.

Unsealed Dragonette- I won't bother trying to think of a normal lv 2 dragon monsters... let alone, extremely subpar :|

Unsealed Graveshuffler- actually plausible, because it's not that hard to dump things in the graveyard. However, there's still better power boosting monsters, and even then...

Unsealed Hero- too bad he's worse than Mystic Swordsman Lv 2 >>;

Unsealed Hydra- let's not even try to imagine just how difficult it is to swarm lv 2 or lower normal monsters, let alone get some reptiles in there (because they are obviously numerous even if we include the effect monsters) to use the Hydra to begin with. OTK material if you insist on using it

Unsealed Illusionist- actually funny, because special summoning disc commander is reasonably plausible and not too situational to do. Stealing dead Il Blud allows you to steal more zombies from the graveyard. Still not that good, but potential to be very funny XD

Unsealed Poltergeist- insanely hard to use... counter productive that it needs the direct attack, but the cost of that is tributing a normal lv 2 monster. Its effect depends on how many of them are out there...?

Unsealed Soot Spirit- the most plausible one to play because it can't ever die without asura priest or trample. As long as it's up, you can't stop this thing. It really doesn't die. Attacking tokens take forever without over committing the field, which is just asking for the tokens to justibreak you. It has some slow burn damage too which is never too bad. It may serve as a decent new method to build up volcanic decks too.

Unsealed Storm... Fiend- AHHHH THE D WORD! The way I see this is a most costly version of the cat at the cost of attacking back row as well. Not as good because higher cost is never nice, plus thunder normal monster? What do I do, run mega thunderball in my deck?

Scarlet Weather November 20th, 2007 8:04 PM

Ultima End
Normal Spell
Send all cards on the field to the graveyard. You may not conduct your battle phase on the turn that this card is played.

Denial of Passage
Continuous Trap
Neither player can declare a direct attack.

Stop, Thief!
Counter Trap
When your opponent draws by using a card effect, negate the effect of that card and destroy it. Then, draw a card.

The Skies Above
Field Spell
All "Wandering" monsters gain one thousand attack points when they battle a monster with higher Atk.

Wrath of the King
Counter Trap
When your opponent activates a trap card, negate the activation of that card and destroy it, then discard one card from their hand.

And now for something completely different....

The Airship Celsius
Monster/Wind/Machine/Effect/7*
Atk 2700/ Def 500
You may normal summon this monster without tribute. If you do, its original attack becomes 1700. When this monster is tribute summoned successfully, destroy all spell and trap cards on your opponent's side of the field.

Pyroclasm
Quickplay Spell
If you have three or more "Limit Break" spell cards in your hand and the corresponding "Wandering" monsters are on your side of the field, you may activate more then one "Limit Break" spell this turn.

Alter Ego November 21st, 2007 6:06 AM

On the normal monster swarm: remember Enchanting Fitting Room. That's up to four normal monsters summoned in one go. Also, Human Wave Tactics has the whole replacement thing, unless your opponent really wants to spend monster removal on level 2 or 1 vanillas. xD

And um...there's Petit Dragon for Dragonette and Gigobyte for Hydra? And you could, uh...use Conger Eel for the storm critter? xD Yeah, revamping Dragonette for something cooler. Also, changed hero for any discard and added a little something for Storm Fiend.

Aaaand I can't believe I forgot about that convention. >.< *Edits names* There, all better.

And fine, I'll admit it: the Soot Spirit is creator's pet. Blame Spirited Away for that. xD


Ultima End: Broken, skipping your Battle Phase only amounts to an effect of the same value as Soul Exchange. At least Magma Burst has the whole trap shtick, only works on Standby Phase, and requires you to remove one fourth of your deck from play first. I say make it end your turn immediately when you use it. x3

Denial of Passage: Basically, the card that all stall decks will run in threes because it's free prevention against all and they don't intend to attack anyway. Tone-down, please, the closest equivalent to this is D.D. Borderline, which demands that you don't have a single spell card in your Graveyard in order to work.

Stop, Thief!: Um, this needs rewording. Make that "When your opponent activates the effect of card that would allow him/her to draw a card(s)". Fair enough, I suppose, screws over Disc Commander and pals, though sadly not in repeat.

The Skies Above: Meh, improved Skyscraper for wanderers.

Wrath of the King: Wow, you just totally killed Trap Jammer and Seven Tools. Free trap negation and discard benefit? I'm looking in vain for a serious activation cost or requirement here.

The Airship Celsius: And we're not running Muthaba instead of this because..? Well, fine, it becomes a decent beatstick even with the no tributes summon. Sort of really overshadows Fusilier Dragon while it's at it too.

Pyroclasm: the 'corresponding' bit needs rewording, I think. Anyway, it's fine I suppose, though I don't really get the name. o.O

Anyways, since I'm feeling sort of lazy:

Unsealed Frost Dragon
Aqua/Fusion/Effect
2 Star/Water
800 Atk / 1900 Def

This card can only be Special Summoned by the effect of "True Power's Release". While this card is face-up on the Field, your opponent may not activate any Spell Cards from his/her Hand and Spell or Trap cards can not be activated until their owner's next turn after setting them.


Aaand something completely different:

Glass Cannon

Rock/Effect
4 Star/Light
2600 Atk / 0 Def

When this card attacks with an Atk that is higher than the Def of your opponent's Defense Position monster, inflict the difference as Battle Damage to your opponent. When this card battles, it is destroyed at the end of the Damage Step. (Damage Calculation is applied normally)

Frostweaver November 21st, 2007 4:49 PM

Unsealed Frost Dragon- is it just me or did Snowhorn/Frosty monsters get permanently tagged on for any effects known as 'screw those spells over'? :3 fair card. Actually destructive enough to almost tempt me to use a lv 3 normal aqua monster in ALO... almost.

Glass Cannon- aka, don't use spear dragon. Use this. Fun stuff for skill drain burn actually because its damage is pretty destructive, decent stall with 2600 atk power while skill drain is out, and definite must have for rock decks.


Magic Eye
Spellcaster/Effect
2 Star/Wind
300 Atk / 300 Def

Whenever a spell card is played, put one Spell Counter on this card. Increase the Atk and Def of this card by 300 for each Spell Counter on your side of the field. Once per turn, during your main phase, you may remove one Spell Counter from this card in order to look at your opponent's hand.


While we're on the endless FF craze... let's see some *true* FF history.

Four Fiends- Lich
Zombie/Effect
8 Star/Earth
2400 Atk / 2000 Def

If this card is tribute summoned, as long as this card is in face up on your side of the field, you may destroy 1 card on your opponent's side of the field for each monster on your side of the field (excluding tokens) during your your end phase. As long as this card is face up on your side of the field, each time a card is destroyed by a card effect, deal 800 damage to your opponent's Life Points.

Four Fiends- Kary
Fiend/Effect
8 Star/Fire
2500 Atk / 2000 Def

If this card is tribute summoned, as long as this card remains face up on your side of the field, check all cards in your opponent's hand, field and cards they draw and destroy ny monster with a star level of 5 or higher. As long as this card is face up on your side of the field, all monsters must be in face up Atk position (flip effects are activated.)

Four Fiends- Kraken
Fish/Effect
8 Star/Water
500 Atk / 2500 Def

If this card is tribute summoned, this card may attack eight times during the same battle phase. Any battle damage this card inflicts to your opponent's Life Points becomes the original Atk of this card. Whenever this card inflicts battle damage to your opponent's Life Points, increase your Life Points by 500.

Four Fiends- Tiamet
Dragon/Effect
8 Star/Wind
2700 Atk / 1400 Def

If this card is tribute summoned and if this card is destroyed by your opponent's effect monster's effect, remove this card from play and special summon this card during your next standby phase. If this card is special summoned this way, destroy all cards on your opponent's side of the field.

Scarlet Weather November 21st, 2007 7:55 PM

Nyu, Frosty, they have to be Wandering Four Fiends or it doesn't count. Celsius didn't get the Wandering title because it's intended as a splasher, and because FFX-2 doesn't follow the pattern of most FF games.

Kraken: So wipe out a massive chunk of the opponent's life points while bolstering your own? Meh, it needs a lot of support to set up so fair enough, I suppose. Skill Drain and LaDD LOL at this card, though.

Tiamet: So Zaborg and Exiled Force get bit, but this thing is still vulnerable to Raiza, Phoenix Wing Wind Blast, Sakuretsu Armor, and Lightning Vortex. Compared to the others, not quite as impressive.

Lich: Ouch. Just Ouch. I'd like to tell you to drop the attack to 2300 to make it Monarch-killable, but I suppose that as is it is pretty balanced. I can see this guy being run in Six Samurai, though. Just imagine: Summon this, call of the haunted on a monster in the graveyard, summon Shien, summon the Shogun, GG. This is an insane destruction engine. The burn effect is icing on the cake.

Kary: The days of Monarch and Cyber Dragon are over forever once this thing exists. Not only do you see everything your opponent has, but you have a permanent crush card virus too? At least make a restriction to Wanderer tributes or slap a special summoning ban. This thing is just too much ouch.

Wandering Red Mage
Monster/Earth/Spellcaster/Effect/4*
Atk 1700/ Def 1600
When this monster destroys an opponent's monster as a result of battle, inflict eight hundred points of direct damage to your opponent in addition to normal battle damage or increase your own life points by eight hundred. If there are two or more "Wandering" monsters on your side of the field, you may use both effects.

Limit Break-Requiem
Normal Spell
Pay half your life points and select one "Wandering Red Mage" on your side of the field. The selected "Wandering Red Mage" gains five hundred attack points during this turn. The Atk of all monsters on your opponent's field becomes zero for this turn only. If "Wandering Red Mage" is the only monster on your side of the field, you do not have to pay any life points to activate this card. You may only activate one "Limit Break" spell card per turn.

Frostweaver November 21st, 2007 9:13 PM

None of the Fiends get their special effect unless it's tribute summoned, you know o_o; All the fiends have 2 effect except Tiamet, and it's always the most destructive one that needs to be tribute summoned. Basically, if you try to book of life Lich, you only get the burn, not the destruction (so good luck using this in samurai deck.) If you try to special summon kary, you only get the attack position force ability, and so on.

Lich needs its own zombie cards to get the Lich out (goodie, Double Coston is also zombie), then special summon to get the destruction engine going. However, Lich itself is really not worth special summoning for... Il Bud is a better choice there.

Kary... because no such thing as fire support exist, just had to make the card strong by itself, and most likely splashed in the same way for LaDD, because they both need strong tribute fodder. LaDD got built in protection and special summon at the end, and since LaDD is now the standard double tribute monster to compare to along with DMoC, I thought that new form of a virus is worth the shot for Kary. Plenty of effect monsters that are lv 4 and lower got monster destruction, though, especially with gladiator beasts and their rampart destruction engine at the lower levels with test tigers and stuff x.x;

Tiamet- yeah i had difficulty because Tiamet doesn't do anything in particular in the game x.x; the funny thing is you fight Tiamet 2 times. The first time he has an ironic weakness to Death spells to kill him in one hit, and 2nd time he doesn't... hence the effect. It's Raigeki + Harpy Feather Duster though if his effect ever works, somehow.

Kraken- hey potential 4000 damage in one turn by itself if it ever works out and hits the clear field, with 4000 LP to you :x

You can special summon them, but most of them lose half or all of their effects.

I didn't put wandering because wandering cards... I don't know, gigantic melting pot of all FFs without any apparently theme together that it reminds me of monarchs? o_o


Red Mage- fair enough besides some wording problems... not sure if this is a reference to any particular character, or just red mages.

Requiem- It's all about summoning Red Mage, or hopefully have a lone Red Mage from the previous turn. Use Requiem, then get the asura priest for gg. If you don' thave the lone Red Mage, a resurrected Hydroggedon or Overload the Game Overdragon works too. Not too useful because really, the only thing about it is the lowered attack power to 0, which is not outstanding too much for a nomi spell. Opponent is laughing if you Requiem and Mirror Force is there, yet you can't get rid of it.


Since we got the "e" word known as evil added to our vocabulary, I introduce...

Embodiment of Evil- Chaos
Fiend/Effect
10 Star/Dark
? Atk / ? Def

This monster cannot be normal summoned or set. This monster can only be special summoned by tributing a "Four Fiends" Monster on your side of the field. The Atk and Def of this card is equal to the total number of cards in play and in each player's hand x 200. Whenever your opponent draws a card, deal 1000 damage to his or her Life Points. If this card is to be removed from the field, select a "Four Fiends" Monster from your graveyard and add it to your hand.

Alter Ego November 22nd, 2007 8:54 AM

Kraken + Robbin' Goblin = hand massacre. Too bad it ain't a beast. If it were, that + Poison Fangs would be an OTKO. xD

Anyways...

Magic Eye: Cool little thing, but the initial attack power is so weak that you'd have to spam a lot of spell cards after summoning it just to keep it from getting wiped out immediately. The hand peek can be very useful, though, although Kary probably handles that better. xD

Lich: now that stings, but considering that it's two-tribute and Ryu Kokki can but heads with it for a draw battle, I don't really see an issue here.

Kary: Big brother is watching. O.O Seriously, I would play this just for the insane amount of information it gathers. Being able to know precisely what your opponent has set (and where) is already a tremendous advantage, and given that this thing wipes out Raiza and other monarchs before they even hit the field, it's pretty much lose every monster you get (either by battle or to the effect) until you manage to topdeck Exiled, D.D. Warrior Lady or some form of spell or trap based monster removal. Worst thing is that your opponent will know precisely what traps you set too, so they can nail them with Dust Tornado or MST as well. I dunno'...this is looking a bit too strong, to be honest.

Kraken: Tee-hee...Kraken is fun. And just imagine what it does in combo with Underdog Power. (Unless your monsters have got less than 500 Atk, they're all dead meat xD) Too bad you can't get the multi-attack if you Damage Condensor this. :3

Tiamet: the only one of these who gets nothing from usual special summon. The effect is strong, but it only gets to use it once, since after that it hasn't been normal summoned to the field but special summoned. Still, the sheer strength of this thing makes it worthy of consideration.

Wandering Red Mage: Fair enough, I suppose, embodies the whole black magic/white magic combo thing, though personally I'd say make the LP gain bigger than the burn since own LP is so low in value.

Limit Break-Requiem: Potential OTKO, potential nothing. Eh...dunno' about this one, but it does have a bit of the reversal flair to it.


Embodiment of Evil- Chaos: oww...just ow. 1000 burn per draw? Drop this down then start spamming those re-draw effects. x3 Oh well, there needs to be quite a bit of cards around to keep this safe from battle, so fair enough I guess.


Anyways...

Vice Mask - Cowardice
Fiend/Effect
4 Star/Light
1300 Atk / 1700 Def

On the End Phase of a turn when you summoned a monster in Attack Position, remove this card in your Graveyard from play. While this card is in your Graveyard, all monsters your opponent summons (Including Flip Summon) are switched into Defense Position.

Vice Mask - Envy

Fiend/Effect
4 Star/Wind
1200 Atk / 900 Def

On the End Phase of a turn when you have more cards on the Field than your opponent, remove this card in your Graveyard from play. During each Standby Phase, if this card is in your Graveyard, select one card on your opponent's Field and destroy it.

Vice Mask - Fury
Fiend/Effect
4 Star/Fire
2000 Atk / 0 Def

This card is forced into Attack Position and can not be switched into Defense Position by any other card effects. During your Standby Phase, you may Special Summon this card from your Graveyard. During the End Phase of your turn, if you did not perform a successful attack that turn, remove this card on your Field or in your Graveyard from play.

Vice Mask - Greed
Fiend/Effect
4 Star/Dark
1300 Atk / 800 Def

On a Standby Phase when you have less than five cards in your Hand, remove this card in your Graveyard from play. While this card is in your Graveyard, you may draw an additional card during each of your Draw Phases. You may only activate the effect of one "Vice Mask - Greed" each turn.

Vice Mask - Malice
Fiend/Effect
4 Star/Fire
1600 Atk / 1200 Def

During the End Phase of your turn, if you did not lose any Life Points this turn, remove this card in your Graveyard from play. During each of your Standby Phases, if this card is in your Graveyard, inflict 800 damage to your opponent.

Vice Mask - Sloth
Fiend/Effect
4 Star/Water
0 Atk / 2200 Def

On the End Phase of a turn when you played more than one card from your Hand, remove this card in your Graveyard from play. While this card is in your Graveyard, your opponent may only play one card from his/her Hand each turn.

Avatar of Vice
Fiend/Effect
12 Star/Dark
? Atk / ? Def

This card can not be Normal Summoned or Set. This card can not be Special Summoned except when there are three or more differently named "Vice Mask" monsters in your Graveyard and this card is in your Hand. You may only have one "Avtar of Vice" on your Field at any given time. The original Atk and Def of this card becomes the number of differently named "Vice Mask" monsters in your Graveyard x 800. This card accumulates effects depending on the names of monsters in your Graveyard:
Vice Mask - Cowardice - When this card would be destroyed or removed from the Field, remove from play one "Vice Mask" monster in your Graveyard in order to return this card to your Hand instead.
Vice Mask - Envy - For each card on your opponent's Field, increase the Atk of this card by 300.
Vice Mask - Fury - All of your opponent's monsters are forced into Attack Position and must attack this card each turn if able.
Vice Mask - Greed - Whenever this card destroys a monster by battle, draw a card.
Vice Mask - Malice - During each of your Standby Phases, inflict damage to your opponent equal to 200 x the number of cards in his/her Hand.
Vice Mask - Sloth - When this card attacks, your opponent may not activate any Spell or Trap cards until the end of the Damage Step.


And yes, putting that last one into an actual card would be murder on the eyesight of anyone reading it. xD

Scarlet Weather November 23rd, 2007 8:46 PM

Cowardice: So basically this set thrives on Foolish Burial, correct? Nice. I like the fact that it makes Monarchs suddenly vulnerable to Shield Crush, and it works wonders with NoC.

Envy: Behold, the great Equalizer! Now this is pretty balanced, but still powerful. I'd say for thematic purposes, trigger the removal when you've got the same number of cards or more on your side of the field. That should do it.

Fury: I'm not sure about the wording on that first line. Anywayz, ouch. Beatstick that keeps coming back to pound the opponent is a definite pain in the butt. Not to mention, this thing makes LaDD mad and LoLs at skill drain like the rest of the set.

Greed: Foolish Burial becomes continuous Jar of Greed? Wowza.

Malice: Most useless one in the set. Your opponent LoLz at eight hundred point burn if he's already swinging for big damage, and if he isn't he just waits a turn to attack. Ho-hum.

Sloth: Okay, this is way too powerful in combination with Greed. Drop Greed the first turn, get Sloth into the graveyard during your next turn, and you get endless two card draws with your opponent limited to one-card moves. Too strong.

Avatar of Vice: But the question remains: What kind of car? XD

Anyway, fair enough I suppose since its attack maxes at 1500 and its a specific summon.

Bounty Hunter-Madog
Monster/Dark/Warrior/Effect/4*
Atk 1700/ Def 500
When this monster destroys an opponent's monster as a result of battle, return this monster to your hand. When this monster is returned from the field to the hand, draw a card.

Alter Ego November 24th, 2007 1:48 AM

Car? I see no car. xD *Prods post* You must be imagining things. ;D

Bounty Hunter-Madog: Dunno' really, it sort of has that spirit monster vibe to it without being a spirit, and I'm not too fond of leaving the field bare like that, even if it does give me a draw. I think I'd sooner go with Yamata Dragon for the cool factor. Maybe give it enough Atk run over Zombie Master at least?

Anyways, you seem to be forgetting about Sloth's maintenance costs ACC. The issue with Sloth + Greed is that you draw two cards each turn, but unless you want to break your own lock you can only play one of them each turn so unless you've somehow fit in an OTKO combo between the masks then you'll just be sitting there with a bunch of cards you can't play until your hand gets too big and you have to start discarding them. (A handy way to drop masks, mind you, but still...)

Also, just because you only get to play one card from your hand each turn, that doesn't mean that's all you get to do. Anything you activate from your field, graveyard or even removed from play pile bypasses the limit, so - for instance - a monarch player could bring back Treeborn and Summon Raiza to bounce something off your field and swing. Zombie could play Premature Burial to bring back Zombie Master, drawing a card with Card of Safe Return then use Zombie Master's ability to discard it - especially if it's a low-level zombie - and pull another zombie from their graveyard for another draw and Big City still suicide-slams and revives with impunity and Demise OTKO can still blast you with Demise, even if they can't follow it up with Dozer. It's not half as solid a lock as it looks since all your opponent has to do is force you into a position where it's play more than one card or die. Besides, every competitive-level deck needs a method for dealing with cards in the graveyard. If they don't have that covered, that's their oversight.

Dunno' is it really that broken? o.o Fine, I'll change it to only count spell and trap cards.

And on Malice: note how it specifies your turn? That means you can keep this in play with something like Messenger of Peace or a similar LP payment effect while sending the bigger damage to your opponent. Still, I think I'll swap this for a more prominent vice. x3


Aaand the avatar's maximal Atk is actually 8100 (all differently named masks in the graveyard and 11 cards on your opponent's field ) but establishing that situation is nothing short of crazy. It starts out at at least monarch-size when you summon it. Hmm...maybe I need to rebalance that, and I've found a way to spread out the effects too. Behold the revamp. :3

Vice Mask - Cowardice
Fiend/Effect
4 Star/Light
1300 Atk / 1700 Def

On the End Phase of a turn when you summoned a monster in Attack Position, remove this card in your Graveyard from play. While this card is in your Graveyard, all monsters your opponent summons (Including Flip Summon) are switched into Defense Position. While this card is in your Graveyard, "Avatar of Vice" on your Field gains the following effect:

- When this card would be destroyed or removed from the Field, remove from play one "Vice Mask" monster in your Graveyard in order to return this card to your Hand instead.

Vice Mask - Envy

Fiend/Effect
4 Star/Wind
1200 Atk / 900 Def

On the End Phase of a turn when the combined number of cards on your Field and in your Hand is greater than or equal to the combined number of cards on your opponent's Field and in his/her Hand, remove this card in your Graveyard from play. During each Standby Phase, if this card is in your Graveyard, inflict damage to your opponent equal to 300 x the number of card in his/her Hand OR on his/her Field. While this card is in your Graveyard, "Avatar of Vice" on your Field gains the following effect:

- Once per turn, after this card has destroyed a monster by battle, if there are more cards on your opponent's Field than there are on yours, this card can attack once again in a row. Whenever this card attacks, increase the Atk of this card by 400 x the number of cards in your opponent's Hand until the end of the Damage Step.

Vice Mask - Fury
Fiend/Effect
4 Star/Fire
2000 Atk / 0 Def

If this card is in Defense Position, it is removed from play immediately. During your Standby Phase, you may Special Summon this card from your Graveyard. During the End Phase of your turn, if you did not perform a successful attack that turn, remove this card on your Field or in your Graveyard from play. While this card is in your Graveyard, "Avatar of Vice" on your Field gains the following effect:

- All of your opponent's monsters are forced into Attack Position and must attack this card each turn if able.

Vice Mask - Greed
Fiend/Effect
4 Star/Dark
1300 Atk / 800 Def

On a Standby Phase when you have less than four cards in your Hand, remove this card in your Graveyard from play. While this card is in your Graveyard, you may draw an additional card during each of your Draw Phases. You may only activate the effect of one "Vice Mask - Greed" each turn. While this card is in your Graveyard, "Avatar of Vice" on your Field gains the following effect:

- Whenever this card destroys your opponent's monster by battle, draw a card.

Vice Mask - Pride
Fiend/Effect
4 Star/Light
1700 Atk / 1200 Def

During the End Phase of a turn when you offered a card(s) as tribute, remove this card in your Graveyard from play. While this card is in your Graveyard, your opponent may not offer any cards on their Field as tribute. While this card is in your Graveyard, "Avatar of Vice" on your Field gains the following effect:

- Once per turn, when this card on the Field would be destroyed, it is not destroyed.

Vice Mask - Sloth
Fiend/Effect
4 Star/Water
0 Atk / 2200 Def

On the End Phase of a turn when you played more than one Spell or Trap card from your Hand (Including Set), remove this card in your Graveyard from play. While this card is in your Graveyard, your opponent may only play one Spell or Trap card from his/her Hand each turn (Including Set). While this card is in your Graveyard, "Avatar of Vice" on your Field gains the following effect:

- When this card attacks, your opponent may not activate any Spell or Trap cards until the end of the Damage Step.

Avatar of Vice
Fiend/Effect
12 Star/Dark
? Atk / ? Def

This card can not be Normal Summoned or Set. This card can not be Special Summoned except when there are four or more differently named "Vice Mask" monsters in your Graveyard and this card is in your Hand. You may only have one "Avatar of Vice" on your Field at any given time. The original Atk and Def of this card becomes the number of differently named "Vice Mask" monsters in your Graveyard x 500.


Aaand...actually, I think I'm throwing in two more for the road. x3

Vice Mask - Lust
Fiend/Effect
4 Star/Fire
800 Atk / 1400 Def

On the End Phase of a turn when there are no monsters on your opponent's Field, remove this card in your Graveyard from play. Once per turn, during your Standby Phase, you may select one face-up monster on your opponent's Field and control it until the end of your turn. A monster controlled by this effect may not be offered as tribute and you may only activate the effect of one "Vice Mask - Lust" each turn. While this card is in your Graveyard, "Avatar of Vice" on your Field gains the following effect:

- Increase the Atk of this card by half the original Atk of each monster on your Field that you control as the result of a card effect. (An original Atk of ? is treated as zero)

Vice Mask - Gluttony
Fiend/Effect
4 Star/Earth
1300 Atk / 1800 Def

During each of your End Phases, if you did not send a card(s) to the Graveyard this turn, remove this card in your Graveyard from play. During each of your Standby Phases, if this card is in your Graveyard, select a card at random from your opponent's Hand and discard it. You may only activate the effect of one "Vice Mask - Gluttony" each turn. While this card is in your Graveyard, "Avatar of Vice" on your Field gains the following effect:

- When this card destroys your opponent's monster by Battle, select a card at random from your opponent's Hand and discard it.


And yes, I know that technically there should only be seven sins, but eight creates a neater number. xP

Haseo, the Sliver Twilight November 24th, 2007 8:04 PM

Fine then, I'll give it what I've got. ...although... Hmm... I'm going to be putting a deck with these cards into my fanfic I'm writing, but I need cards that can support it. Can anyone help me?

It's based off of Kingdom Hearts, mainly CoM/Chain of Memories.)

Fairytale Hero (Sora)
LV.4
1600/1000
Normal Monster

Princess of Heart (Kairi)
LV.3
600/1400
Effect: If "Fairytale Hero" is on your side of the field, it cannot be removed from the field by your opponent's spell and trap cards.

Half Hero (Roxas)
LV.4
1600/1000
Normal Monster

Princess of Memories (Namine)
LV.3
600/1400
Effect: If "Half Hero" is on your side of the field, it cannot be removed from the field by your opponent's spell and trap cards.

[Name still in progress] (Riku)
LV.4
1800/500
Effect: If "Fairytale Hero" or "Princess of Heart" is on your side of the field, increase this cards ATK by 200.

False Friend (Riku Replica)
LV.4
1800/500
Effect: If "[Name in progress]" is on your side of the field, increase this card's ATK by 200.

Amnesia
Spell Card
Effect: Double the ATK of one "Fairytale Hero" on your side of the field if "Princess of Memories" is on your side of the field. At the end of the turn, shuffle this card's target back into your deck.

Sketchbook
Equip Spell
Effect: This card may only be equipped to 'Princess of Memories". Once per turn, instead of conducting your draw phase, you may add one "Amnesia" from your deck to your hand.

Castle Oblivion
Field Spell
Effect: If "Princess of Heart" is on your side of the field, remove it from the game. All cards that include "Princess of Heart" in their card text are changed to "Princess of Memories". When "Princess of Memories" is on the field, "Fairytale Hero" cannot be removed from the field by the effcet of your opponent's spell or trap cards. At the cost of 500LP, you may choose not to shuffle "Fairytale Hero" into your deck by the effect of "Amnesia".

Chain of Memories
Continuous Spell
Effect: Increase the ATK of all "Fairytale Hero" and "False Friend" on the field by 500. You may negate the destrouction of a card listed in this card's text by discarding a card from your hand. This card is destroyed and sent to the raveyard if "Amnesia" is activated, and you lose 1000LP.

Hero's Call
Trap Card
Effect: Special Summon one "Fairytale Hero" from your Hand, Deck, or Graveyard.

Hero's Duty
Continuous Trap
Effect: You may redirect any attack on one one "Prioncess of Heart" to one "Fairytale Hero" on your side of the field. You may also redirect an attack on one "Princess of Memories" to one "Half Hero".

(Any suggestions on how to improve this? I haven't finished building the deck, but I'd like to see if anyone else has any ideas for it.)
(Anyway, thanks for reading - because i'm not quite sure what exactly we're doing here.)

Alter Ego November 25th, 2007 2:03 AM

First of all, these monsters of yours need types and attributes. Normal monsters should also have a flavor description to go with them. Follow the format, please. D=

Sora: Crappy vanilla, and it doesn't even hit under Gravity Bind or Level Limit either. At least make it 3-star. >.<

Kairi: Tries to turn the aforementioned crappy vanilla useful, but unfortunately fails because this card is so frail that keeping it alive on the field is not worth the bother. Lord of D. had way more usefulness than this, and that card sucks too. :\

Roxas: A clone of the crappy vanilla. Fitting, I suppose, but not useful.

Naminé: And a clone of the crappy vanilla's failing support monster. 'Nuff said.

Riku: And we are not just running Gene-Warped Warwolf (2000 Atk, 4 star normal monster) instead of this because..? It's a mediocre vanilla that doesn't enjoy vanilla support.

False Friend: we love our copy monsters, yes we do. Does each and every one of thse pairs have to be identical? It's not like they were perfect copies of each other in the games. -.-

Amnesia: Reword that, please: "This card can only be activated by selecting a face-up "Fairytale Hero" on your Field while "Princess of Memories" is face-up on your Field. Double the Atk of the selected monster. On the end of the turn this card is activated, shuffle the selected monster into your Deck." Bleah, it tries to turn Sora useful but fails at it because we still need to assemble two wimpy monsters on the field at the same time. I'd sooner go for Oppressed People, People Running About, and United Resistance to get my hands on Great Revolution. And those cards bite. D=

Sketchbook: Still doesn't change the fact that we have to keep that sucky monster on the field and this card alive for a whole turn if we even want anything out of this, and even then it's a -1 because you have to give up your Draw Phase. Just...no.

Castle Oblivion: So basically we want to spam three Amnesia and have Sora sit around on the Field with 12800 Atk. I honestly can't decide whether to go for the crappy aspect or the broken one. I'll just say 'disbalanced' and leave it at that.

Chain of Memories: Wording issues, again. "If 'Amnesia' is activated while this card is face-up on the Field, this card is destroyed and you lose 1000 Life Points". Also, you're missing a 'G' in 'Graveyard'. What's with this thematic? All the cards are picking on each other. x.O

Hero's Call: pointless. There are far easier ways to summon our sucky vanilla monsters already.

Hero's Duty: Now why does this remind me of Jam Defender? Oh yeah, effect that's basically meant to be useful but is way too selective to ever be worth it. No way am I wasting a backrow slot on this.


Just...way too weak cards, except for the Oblivion + Amnesia combo which is just plain disbalanced. These could use some serious revision and a unifying theme, not to mention a clearer link to their KH counterparts ability-wise. Besides, where's Donald and Goofy? =O

Anyways, just a loose card:

Martyr Guard
Continuous Trap

Once per turn, during your opponent's Battle Phase, by tributing one monster on your Field you may negate the attack of a monster controlled by your opponent and end the Battle Phase immediately.

Frostweaver November 25th, 2007 1:49 PM

Cowardice- interesting i guess... decent for stall to certain extents, and more fun for D. D. Crow XD;

Envy- Avatar will basically never get to use its effect, since avatar is meant to destroy things with destructive number of effects, and this card almost always remove itself after blowing up one thing. You need Ojama Trio to use this decently.

Fury- except what is a successful attack?

Greed- impossible to use... you'll probably be easier to win when you have 6 cards in your hand and use them all, instead of holding on to it.

Pride- We got a winner! Any deck that doesn't use tributes (so monarchs) should think about this. Stops all virus. Stops monarchs. Good attack power. It's splashable too. Even burn deck can use this as a decent beatstick with more protection against monarchs against the back row in case if your defense aren't up yet (if you got space.)

Sloth- Shien's effect for everyone... i can see potential but i can't think of anything yet right now.

Lust- tokens for the win! Ojama trio will always ensure that there is something out there =x and we all know that brain control is strong. Lust can't tribute, but still we can use it to remove defenses (since it can steal facedown too.) Flipping stolen monsters is evil... this is really insane, to be honest x.x;

Gluttony- the difficulty of sending a card to the graveyard each turn on a consistent basis is beyond difficult...

Avatar of Vice- can't use cowardice (avatar WILL be in atk mode), envy is such a meh ability, not sure about fury cause what is a successful attack, can't use greed, and can't use gluttony... so we're really down to 3 vice masks that are usable with avatar in the end, o_x; and we need 4... Hmmm.

Matyr Guard- i think that I like Ordeal of a Traveler more... this is some expensive stuff just to negate battle phase, and it's continuous trap (worse kind out there, easiest to be destroyed.)



The KH monsters... yes they need attribute, type and so on... like what Alter Ego said.


Sora- >>;

Kairi- stats are beyond horrible... and even the effect is really meh. It doesn't stop destroyed effects, so we're only stopping phoenix wing wind blast to be honest. No...

Roxas- they aren't THAT identical... I mean, Roxas has a more popular fanbase and more fanservice than Sora can ever imagine in fanfics :3

Naminé- darn it no one ever uses the accent ;_; and for making my absolute favorite char in any game with such craptastic effect, I'll call this a fail. Not to mention, she is not a princess in any way shape or form.

Riku- yeah... gene warped warwolf is better, and een that card is considered failure.

Riku Replica- a weak card that relies on another weak card to get a weak effect... weak.

Amnesia + Sketchbook + Castle Oblivion- we're again looking at 4-5 (the 5th card being double summon or else you can't get out Naminé and Sora out at the same time... except Shining Angel on the previous turn. Thus, 4-5 cards) card combos just to pull off OTK, and there are faster ones to do it. Strangely enough, Naminé offers protection to Roxas yet not Sora, and the OTK uses Sora... so Naminé is just sitting there as activation requirement. In theory, this is actually even slower than Ultimate Tyranno, Ojama Trio and Final Attack Orders, and when did that OTK ever worked?

Chain of Memories- we're missing the point of CoM here ><; if anything, Chain of Memories should stay on the field if there is amnesia, because it's how Naminé makes Sora forget about Kairi and replaces Kairi with herself that served as a chain to bound Sora down...

Hero's Call- alternate to double summon in the OTK, guess moderately faster... but a trap, ew.

Hero's Duty- and it's not like the princesses stop destruction effects >_<;


And now you tempted me to join the fanservice to make KH cards o_o But more FF6 stuff to go through first!


Magitek Armored Soldier
Machine/Effect
4 Star/Dark
1700 Atk / 1800 Def

Whenever a spell card is played, put 1 Spell Counter on this card. Increase the Atk power of this card by 200 for each Spell Counter on this card. Remove 2 Spell Counter from this card to destroy 1 monster whose Def is lower than the original Atk of this card.

Scarlet Weather November 25th, 2007 6:34 PM

Let's see if I can't turn the Kingdom Hearts problem around. I mean, I did come up with the whole "Wandering" concept, and it can't be too much harder...

Oh, and I'll be changing the names around a bit.

Wielder of the Key
Monster/Light/Warrior/Effect/4*
Atk 1600/ Def 1500
When this monster is normal summoned or set, look at the top card of your deck. If that card includes the word "Heart" in its name or that is named "Wielder of the Key-X", you may special summon it. A monster summoned in this way cannot attack on the turn it is summoned or be offered as a tribute, and is sent to the graveyard when this monster is destroyed.

Princess of Heart
Monster/Water/Spellcaster/Effect/4*
Atk 1000/Def 1000
If this monster is special summoned, "Wielder of the Key" cannot be removed from the field by card effects. Once per turn, discard one card from your hand in order to place one "Heart Counter" on a monster on your opponent's side of the field. Monsters with "Heart Counters" cannot destroy this monster as a result of battle.

Guardian of Heart
Monster/Earth/Beast-Warrior/Effect/4*
Atk 1550/ Def 1700
When this monster is face-up on the field, you may change the target of one of your opponent's attacks to this monster. If "Wielder of the Key" is on the field while this monster is face-up on the field, increase the attack of "Wielder of the Key" by five hundred points until this monster is removed from the field.

Royal Magician of Heart
Monster/Water/Spellcaster/Effect/4*
Atk 1700/Def 1500
If "Wielder of the Key" is face-up on the field when this monster inflicts battle damage to your opponent's life points, you may place one spell card from your graveyard on the top of your deck.

Blade of Heart-Key
Equip Spell
If "Wielder of the Key", "Wielder of the Key-X" or "Twilight Warrior of Heart" is face-up on your side of the field, you may add this card from your deck to your hand instead of conducting your normal draw phase. This card may only be equipped to "Wielder of the Key", "Wielder of the Key-X", or "Twilight Warrior of Heart". Increase the equipped monster's attack by eight hundred points. If the equipped monster would be destroyed as a result of battle, destroy this card instead.

The King of the Key
Monster/Light/Beast-Warrior/Effect/6*
Atk 2400/Def 2000
This monster's name is treated as "Wielder of the Key" for the purpose of determining card effects. While this monster is face-up on the field, increase the attack of all monsters with "Heart" in their names by five hundred points.

Wielder of the Key-X
Monster/Dark/Warrior/Effect/4*
Atk 1600/Def 1500
If this monster and "Wielder of the Key" are face-up on your side of the field, you may tribute both monsters in order to draw two cards from your deck. By paying five hundred life points, this card may attack twice during the same battle phase.

Witch of Memory
Monster/Light/Spellcaster/4*
Atk 1000/Def ????
This monster's original Def becomes half the combined Def of all "Heart" monsters and "Key" monsters on your side of the field. This monster may be normal summoned in defense position. Your opponent may only select this monster as an attack target or as a target for spell cards. When this monster would be destroyed, you may destroy a "Wielder of the Key" or "Wielder of the Key-X" that you control instead.

Hmm... Namine (since I can't do the accent, period) is just nomi wall of doom, but I'm not too clear on her role in CoM anyway, having only played I and II. Oh, and I suppose I should work on Wandering crossovers now that I'm on this theme. XD

More Kingdom Hearts monster to follow, I guess, specifically because support spells and Riku still don't exist.

Twilight Warrior of Heart
Monster/Dark/Warrior/Effect/4*
Atk 1900/Def 1200
This monster's attribute is also considered to be "Light". If "Wielder of the Key" or "Princess of Heart" is face-up on the field when this monster is normal summoned, destroy one monster card OR one spell or trap card that your opponent controls.

Castle of the King
Field Spell
Increase the attack of all "Heart" and "Key" monsters by three hundred points. Once per turn, by paying eight hundred life points you may place one "Heart" or "Key" monster on top of your deck.

Shadow Corridor
Counter Trap
When your opponent declares an attack on a "Key" or "Heart" monster you control, negate the attack and discard one card from the opponent's hand to the graveyard.

Unlocking of Heart
Normal Spell
Activate only while "Blade of Heart-Key" is equipped to a monster on your side of the field. Special summon one "Heart" or "Key" monster from your deck.

Combo Limit-Eternal Session
Normal Spell
Pay half your life points and select one face-up "Wielder of the Key" and "Twilight Warrior of Heart". Increase the attack points of both monsters by five hundred until the end of the battle phase. The effected monsters may attack your opponent's life points directly. If "Wielder of the Key" and "Twilight Warrior of Heart" are the only monsters on your side of the field, you do not need to pay life points to activate this card. You may only activate one "Combo Limit" spell per turn.

Alter Ego November 26th, 2007 1:01 AM

*Cough* I use the accent, you know. But yes, poor Naminé suffers a lot of abuse from uneducated people who don't have consideration for accents. D=

Anyways, a successful attack is an attack where Damage Calculation is applied. (meaning that it's not negated by any effect shenanigans) Unless there's some better term for that? :3

Aaand, I'll cut down on greed's requirement. Let's make that four cards, even though that basically means that you only have to conserve two in your hand because Draw Phase comes around before Standby. And...my Soil Erosion Continuous Trap (remember, the one you knocked for being redundant? xD) makes Gluttony's maintenance about as painless as it can be. Anyways, I revamped Envy. Better now? :3

Magitek Armored Soldier: Yaaay! Magitek, Magitek, Magitek! ^0^ Whaaat...I liked using those armors, alright? Especially Terra's with the whole X-Fering my opponents to oblivion bit. >D Anyways, definitely useful. Two counters is already enough for it to be on par with Cyber Dragon and wipe it out by the destruction effect and unlike Magical Marionette you don't need to tribute for this. It's also big enough to wall most non-tributes if it comes to that.

Wielder of the Key: Ehh...so our extra muscle goes bye-bye with this? Oh well, it's a quick boost in field presence that doesn't hurt the hand, so fair enough, I suppose. Certainly beats the sucky vanilla. :3

Princess of Heart: Kairi is still all weak in stats. D= The heart counter thing isn't really helping since your opponent will just summon a new monster next turn and squash this. Let's give her something a bit more substantial in the way of defensive abilities, shall we? And like, maybe some actual usfeulness too?

Guardian of Heart: The last effect is needlessly complicated. Just say, "While this card is face-up on the Field, increase the Atk of each "Wielder of the Key" on your Field by 500.". Anyway, Goofy is being pretty weak on the defensive, but then again he's not that useful in the games either, so...well, at least give him 1800 Def to wall Zombie Master/Stratos.

Royal Magician of Heart: Is it just me or is Donald being waaay too useful compared to his ingame counterpart? xD I dunno', I think this is a bit too strong. Yes, it's placing on the top of the deck, but that basically translates to infinite monster or S/T removal for you (ensuring that you get that battle damage done each turn) and this is already quite strong in its own right. Maybe make it destruction by battle at least?

Blade of Heart-Key: only protection from battle destruction and a mediocre Atk boost? Seems sort of weak, but at least it self-searches. *Shrug*

The King of the Key: Mickey is a more troublesome-to-summon Command Knight for his buddies without self-protection? Again, this sort of isn't mirroring his role as the person who keeps mysteriously vanishing after telling people what they should be doing, but whatever.

Wielder of the Key-X: Well, at least it's got Roxas' whole crazy speed thing implemented somehow, though you'd have to be pretty desperate to sacrifice two cards on your field for two from your deck.

Witch of Memory: Actually, her defenses suck since it would take at least three monsters just to bump her over the Zombie Master/Stratos threshold. A monster that needs three others on the field to wall isn't really a wall. D= Anyway, this...just doesn't really look like Naminé to me. :\ I mean, her big thing is her ability to manipulate people's memories, so I'd like to see that reflected in the effect somehow. Maybe a Mind Wipe style effect (Make your opponent shuffle their hand into the deck and draw a new one)? Eh...I'll just leave this one for Frostweaver to figure out. xD

Twilight Warrior of Heart: And why don't you just say "Select one card on your opponent's Field and destroy it."? It amounts to precisely the same thing. Anyway, fair enough, though I'd like to see his whole "protecting Kairi" shtick in here somewhere.

Castle of the King: Place a card from where on the top of your deck? Specify, please. Anyways, obvious synergy with Sora here, but I really see no other reason to consider this.

Shadow Corridor: No need for that 'to the graveyard' bit. By default, that's where it goes when you're discarding. You should also specify if it's chosen at random or by either player. Makes quite the difference.

Unlocking of Heart: More swarming, and more purpose for the keyblade.

Combo Limit-Eternal Session: "Selected" rather than "Effected". Fair enough, I suppose, though given all the flash of that limit break I was expecting something a bit more grandiose from the effect. x3 But you know, you could just have added a line saying "This card is treated as a "Limit Break" Spell Card" and used the regular Limit Break wording.


Anyways, adding a little something to this

Combo Limit - Trinity Limit
Normal Spell

This card is treated as a "Limit Break" Spell Card. Pay half your life points and select one face-up "Wielder of the Key", one face-up "Guardian of Heart" and one face-up "Royal Magician of Heart" on your Field. Until the end of the turn this effects is activated, the Atk of each of the selected monsters becomes half the combined original Atk of the selected monsters and each of the selected monsters can attack three times in the same Battle Phase. Whenever one of the selected monsters inflicts Battle Damage this turn, that Battle Damage becomes 500. If the selected monsters are the only monsters on your Field, you do not need to pay any Life Points to activate this card. You may only activate one "Limit Break" Spell Card each turn.

Limit Break - Dark Aura
Normal Spell

Pay half your life points and select one face-up "Twilight Warrior of Heart" on your Field. On the turn this card is activated, the selected monster may attack all monsters on your opponent's Field.When the selected monster attacks a monster on the turn this effect is activated, you may switch the Battle Position of the attacked monster before applying Damage Calculation. (Card effects are not activated) If "Twilight Warrior of Heart" is the only monster on your Field, you do not need to pay any Life Points to activate this card. You may only activate one "Limit Break" Spell Card each turn.

Charm of Memories
Equip Spell

This card can only be equipped to "Wielder of the Key". All effects or attacks that would target "Princess of Heart" target the equipped monster instead. On the End Phase of a turn when a monster was destroyed while equipped with this card, Special Summon the destroyed monster to your Field then equip this card from your Graveyard to that monster. You may only have one face-up "Charm of Memories" on your Field at any given time.

Charm of False Memories
Equip Spell

This card can only be equipped to "Wielder of the Key" or "Twilight Warrior of the Heart". Once per turn, when the equipped monster would be removed from the Field it is not removed from the Field. While this cards is face-up on the Field, all attacks or card effects that would target "Witch of Memories" target the equipped monster instead. If "Charm of Memories" is on your Field, this card is removed from play.

Aaaand because they're so darn fuzzy-wuzzy cutesy:

Heartless - Green Requiem
Fiend/Effect
3 Star/Earth
1000 Atk / 1800 Def

This card is not affected by Spell Cards. Each time a Spell Card is activated while this card is face-up on the Field, gain 500 Life Points.

Heartless - Blue Rhapsody
Fiend/Effect
3 Star/Water
1300 Atk / 1600 Def

Whenever this card Battles with a Water Attribute monster, this card is not destroyed and all Battle Damage you would receive from the battle becomes zero. Then, you gain a number of Life Points equal to the amount of damage you would have received. Once per turn, you may select a number face-down cards on your opponent's Field up to half the number of "Heartless" monsters on your Field (rounded up to the nearest whole). Your opponent may not activate any effects of the selected card(s) until the end of the turn this effect is activated.

Heartless - Red Nocturne
Fiend/Effect
3 Star/Fire
1500 Atk / 1300 Def

Whenever this card Battles with a Fire Attribute monster, this card is not destroyed and all Battle Damage you would receive from the battle becomes zero. Then, you gain a number of Life Points equal to the amount of damage you would have received. Once per turn, inflict 300 damage to your opponent for each "Heartless" monster on your Field.

Heartless - Yellow Opera
Fiend/Effect
3 Star/Light
1600 Atk / 800 Def

Whenever this card Battles with a Light Attribute monster, this card is not destroyed and all Battle Damage you would receive from the battle becomes zero. Then, you gain a number of Life Points equal to the amount of damage you would have received. If a "Heartless" monster on your Field destroys a monster by Battle while this card is face-up on the Field, inflict 800 damage to your opponent.

Heartless - Crescendo
Fiend/Effect
2 Star/Dark
700 Atk / 1500 Def

During each of your Standby Phases, if this card is face-up on your Field you may Special Summon one level 3 or lower "Heartless" monster from your Deck.

Heartless - Darkball
Fiend/Effect
5 Star/Dark
0 Atk / 2300 Def

During each of your Standby Phases, increase the Atk of this card by 500 for each "Heartless" monster on your Field. When this card attacks, the Atk of this card is reduced to zero at the end of the Damage Step. Then, you may switch this card into Defense Position.

Heartless - Pirate
Fiend/Effect
4 Star/Dark
1650 Atk / 800 Def

When this card attacks, all Battle Damage you would receive from the battle becomes zero and this card is not destroyed. A monster that battle with this card can not attack or change its Battle Position until its controller's third Battle Phase after this effect's activation.

Heartless - Shadow
Fiend/Effect
1 Star/Dark
700 Atk / 500 Def

When this card is summoned successfully (Including Flip Summon) you may Special Summon a number of Heartless Shadow Tokens (Dark Attribute/Fiend Type/1 Star/700 Atk/500 Def) to your Field up to the number of monsters on your opponent's Field. Heartless Shadow Tokens may not be offered as tribute except for the tribute summon or effects of "Heartless" monsters.

Heartless - Tornado Step
Fiend/Effect
3 Star/Wind
1700 Atk / 1300 Def

When this card attacks, roll a six-sided die once. Treat your opponent's Monster Card Zone as #'s 1-5, counting from your right. This card attacks the monster that is in the same Monster Card Zone as the die result. If the result is six or there is no monster in the same Monster Card Zone as the die result, this card attacks your opponent directly instead.

Heartless - Large Body
Fiend/Effect
5 Star/Dark
2000 Atk / 2400 Def

Once per turn, when this Attack Position card would be destroyed by battle, it is not destroyed and the monster this card battled with is switched into Defense Position instead.

Heartless - Darkside
Fiend/Effect
10 Star/Dark
? Atk /? Def

This card can not be Normal Summoned or Set. This card can only be Special Summoned by tributing all "Heartless" monsters on your Field while this card is in your Hand. The original Atk and Def of this card becomes the combined original Atk of all monsters tributed for this effect. While this card is on the Field, it can use the effects of all Effect Monsters tributed for this card's effect.


Erm...yeah. xD Some of these effects are inspired by CoM, such as Darkside's effect copy and Pirate's stun effect (Gawd, I hate that attack >_<).

Scarlet Weather November 26th, 2007 5:53 PM

Hmm... the real question is how useful Kairi is in the actual games. All she does is wait for Sora to rescue her (or alternatively, run around and get captured by Organization XIII until Riku rescues her). She has one fight with a borrowed Keyblade, then nothing.

As for King of the Key, I needed somebody to boost stats. Don't forget, he is searchable by unlock.

Witch of Memory
Monster/Light/Spellcaster/Effect/4*
Atk 1000/Def 2200
This monster is normal summoned or special summoned in defense position. Once per turn, you may pay five hundred life points to select one random card in your opponent's hand and place it on the bottom of their deck. Then your opponent draws a card.

Princess of Heart
Monster/Water/Spellcaster/Effect/4*
Atk 1000/Def 2200
This monster is switched to defense position when it is normal or special summoned. While this monster is face-up on the field, all "Key" monsters and "Twilight Warrior of Heart" that you control cannot be removed from the field by card effects. Once during your main phase, discard one card from your hand in order to place one "Heart Counter" on an opponent's monster. Monsters with a "Heart Counter" may not activate their effects.

Two Crossed
Equip Spell
This card may be added to your hand from your deck instead of conducting your normal draw phase. This card may only be equipped to a "Key" monster or "Twilight Warrior of Heart". When this card is sent to the graveyard as a result of the equipped monster being destroyed, special summon one "Wielder of the Key" and one "Wielder of the Key-X" from your hand or deck.

I'll comment on the heartless in full later, though I've got to say that Darkside is pushing it. Drop down pirate, follow it the next turn with shadow to duplicate an opponent's swarm (with zombies and Six Samurai, we're talking major pain) and then tribute away. You have instantly summoned a monster with a minimum attack of 2350 with a stun ability and token summoning. I'd say that maybe all effects or total combined attack is pushing it. That's not even getting into the horrors this thing causes with Crescendo and the colored musics.

Alter Ego November 28th, 2007 4:21 AM

Well, if we're going down that road: how useful is Donald in the games? xD

Anyways, revamps:

Witch of Memory: Well, at least she's got tougher defenses now (Oh Geear Golem, move over; your replacement is here. ;D). The replacement effect is a bit of a gamble because you have no idea what you're replacing (or what your opponent will get in exchange) so it's liable to bite you in the leg. Don't know if I'd use it. Hard to say how that effect could get more useful without overpowering it, though...hm...how about you get to declare a card type and your opponent must select a card of that type to put at the bottom of the deck? Or at the very least add an effect let you see the card your banishing to the bottom of the deck?

Princess of Heart: Better. The combined abilities of protection and effect negation definitely make this a keeper. (Considering the power of that ability, I think you could cut the Def to the 1800/1900 range, actually) Now throw in Charm of Memory and Twilight Warrior and we have one annoying combination. x3

Two Crossed: don't we have enough equip already? xD Well, the whole turning one into two bit will really make your opponent want to spend some S/T removal before they attack, unless they're running Raiza in which case they just laugh at your wasted equip. Mmmhmm...I still think this effect (with a little wording change) could work just as well as Normal Trap or Quick-Play Spell.


And Darkside is powerful, yes, but it's also a major loose cannon. First off, the wording demands that you give up everything suitable that you have on your field for the summon; no pick and choose business. Second, it also has a glaring weak against all forms of field bounce (*cough* Raiza *cough*) and unless you mold Green Requiem in there it is equally vulnerable to any and all other ways to dispose of big monsters so it's putting all your proverbial eggs into one big proverbial basket, not to mention that Skill Drain laughs itself silly over this. Also, while the combined Atk thing may seem a bit hefty, do consider that you have to build up a lot of field presence to make it worth your while. Ra tried to pull this shenanigans before, and we all know how well that worked.

Oh well, I'll restrict it to only use the effects of the tribute monsters (as opposed to everything on the field). :3


Anyways...

Fateful Premonition
Normal Spell

Select one card from your Deck and remove it from play face-down. (Neither player may look at this card) At any time during the duel, when your opponent summons or activates the effect of a card, you may reveal the card removed from play by this card's effect. If the card your opponent played has the same name as the card you revealed, negate the summoning or activation of that card and remove it from play, then add the card you revealed to your Hand.

Eon-Rider November 28th, 2007 4:59 AM

Fateful Premonition: Was that a card purposely "made" by you to recreate the card that Yugi used against Atemn?

Alter Ego November 28th, 2007 5:31 AM

That card was a basis, but it's not identical. As far as I know, Yugi's sealing chest thingie only did a regular negation, this also removes from play and gives you a copy of the card you negated for own use, so it's meaner. I sort of thought of this as extreme prediction with proper payback. x3

Waker of Chaos November 28th, 2007 1:18 PM

Evil Elitist
DARK Fiend-Type
Level 4 ATK 3000 DEF 0

If this card is in face-up Attack Position, you lose the Match. This effect cannot be negated. This card cannot exist in your Graveyard or Removed Zone. If this card is in your Deck, add it to your hand and shuffle your Deck.

This represents all the, "Competitive dueling is the only way to be! If you don't use a Meta Deck, then you suck, fail at life, and need to kill yourself! Stop polluting the game with your fun and creativity!" people. These are the same idiots who would Normal Summon the above card, because like in the anime (The Winged Dragon of Ra had that ancient Egyptian text that could only be visible when the card was Summoned), this card's effect can only be seen when it's Summoned (just the underlined bit though). With 0 DEF, I really doubt someone will put it in Defense Position, since monsters with more than 3000 ATK are hard to get to the field.

Scarlet Weather November 28th, 2007 2:38 PM

Mmmmkay..... let's not be too hasty there. There is nothing wrong with playing just for fun, but there is something wrong with insulting people who don't deserve it. Not all competitive duelists are elitists, y'know. *glances at Marauding_Master* On second thought.... XD

Oh, but that card is useful, you know. There are a lot of new cards coming out that like having dark monsters in the graveyard to remove from play, and it works with Shroud of Darkness (discard a dark-type monster from your hand, draw a card). It even works with Skill Drain, which negates the abilities of all monsters on the field. No, I don't see it getting competitive use anytime soon, but that thing isn't as completely useless as you thought. XD

The Decisive Battle
Quickplay Spell
Select one "Wandering", "Heart", or "Key" monster on your side of the field and one monster on your opponent's side of the field with the same or higher attack points. For this turn only, the attack of the selected "Wandering", "Heart" or "Key" monster is increased by the original attack points of all other monsters on your side of the field. During this turn, only the selected monster can attack, and he may only target the selected monster on your opponent's side of the field. If this card is activated during your opponent's battle phase, you must skip your own.

Waker of Chaos November 28th, 2007 2:44 PM

Quote:

Originally Posted by ACC-M (Post 3124475)
Mmmmkay..... let's not be too hasty there. There is nothing wrong with playing just for fun, but there is something wrong with insulting people who don't deserve it. Not all competitive duelists are elitists, y'know. *glances at Marauding_Master* On second thought.... XD

Well, you have your competitive duelist, who plays to win but doesn't mind helping out with the creative and fun Decks, and is possibly even known to use them for fun himself/herself.

Then you have your elitist bastard who thinks you suck balls and should kill yourself to lessen the amount of "noobs" who play the game, just because you decide to run something like Destiny Board rather than Destiny Heroes.

Quote:

Originally Posted by ACC-M (Post 3124475)
Oh, but that card is useful, you know. There are a lot of new cards coming out that like having dark monsters in the graveyard to remove from play, and it works with Shroud of Darkness (discard a dark-type monster from your hand, draw a card). It even works with Skill Drain, which negates the abilities of all monsters on the field. No, I don't see it getting competitive use anytime soon, but that thing isn't as completely useless as you thought. XD

I'll edit it so it'll lose you the Match if it's not in your hand or on the field, then.

Oh, by the way... It's "Veil of Darkness". It was released in Gladiator's Assault.

Scarlet Weather November 28th, 2007 4:07 PM

Hmm? AE said it was shroud, so I blame him. XD

Anyway, I don't play IRL. I'm strictly a WC07 player (or I am once I get my hands on the game. XD) How should I know what it's called? *assumes picture of innocence*

Hmm... I'd say that insulting people with cards shouldn't assume that they're idiots who won't play-test before they go into battle. They'd summon it on their own with a friend and see the effect before they ever played it. Instead, use the power of made-upness. XD

Diplomacy
Normal Spell
If you are a member of Pokecommunity forums using the username "Marauding_Master", you are not allowed to place this card in your deck or sidedeck. By showing this card to your opponent after you have been defeated, you win the match.

Shameless Insulting
Normal Spell
If your are a member of Pokecommunity forums using the username "Marauding_Master", you must run three copies of this in your main deck at all times and use at least one copy during a duel. Lose half your life points. No cards may be chained to this card's activation.

Complete Elitist Freak Doom Dealer of Rabid Porcupines
Monster/Dark/Beast/Effect/11111111111111111111111111111111111*
Atk 0000/Def 0000
This monster may not be played in defense position. If you have ever ridiculed someone for playing YGO just for fun, you must play three copies of this monster in your deck and summon at least one during a duel. When this monster is summoned, your opponent may punch you in the nose and steal your deck. If you cannot chase them down within ten seconds, you lose the duel and all your cards, and must give up playing children's card games forever.

IT'S JUST A CARD GAME!!!!
Counter Trap
Activate in response to your opponent's elitist behavior. Shock them back to reality.

Marauding_Master will officially regret ever calling me a moron. XD

Haseo, the Sliver Twilight November 28th, 2007 6:20 PM

You guys' improvement on my cards helps alot. I'm going to mention you all (but I'll only track down who made each when I finish writing the chapter the card appears in) in the fic, so thanks for the help.

The Chain of Memories card was a reference to Sora's old memories. It's destroyed by Amnesia, because that represents the drive given to him by his new memories.

I'll put what I was thinking for the Organization XIII out here now.

The 13 - The Superior
3000/3000
8 Stars
Spellcaster
DARK
Effect: Once per turn, you may discard one card from your hand to negate the attack of an opposing monster and inflict 500 points of damage to your opponent's life points.

The 13 - The Freeshooter
1900/1200
4 Stars
Warrior
LIGHT
Effect: Once per turn, you may add one spell card from your graveyard to your deck and shuffle it. If you do, this monster deals 700 points of damage to your opponent's life points. (This does not count as effect damage.)

The 13 - The Whirlwhind Lancer
2200/2000
6 Stars
Warrior
WIND
Effect: This card may not be normal summoned or set. This card may only be special summoned when you deal battle damage to your opponent's life points. Once per turn, return one monster on the field to it's owner hand. This effect may not be activated if there are no "The 13" cards oher than this one face up on your side of the field.

The 13 - The Chilly Academic
1400/1200
4 Stars
Spellcaster
WATER
Effect: This card may not be destroyed as a result of battle. If this card is returned to the hand by a card effect, discard it.

The 13 - The Silent Hero
2500/1000
5 Stars
Warrior
EARTH
Effect: This card may not be normal summoned or set. This card may only be special summoned by the effect of "The 13 - The Cloaked Schemer". This card deals damage through defense.

The 13 - The Cloaked Schemer
1000/1900
4 Stars
Spellcaster
DARK
Effect: When your opponent special summons a monster, you may special summon one "The 13 - The Silent Hero" from your hand or deck. When this card is sent to the graveyard, Special summon one "The 13 - The Silent Hero" from your graveyard to the field.

The 13 - The Luna Diviner
1500/1000
4 Stars
Warrior
LIGHT
Effect: When this card decalres an attack target, flip a coin. If heads, increase this card's ATK by it's DEF for damage calculation only. If Tails, return this card to it's owner's hand.

The 13 - The Flurry of Dancing Flames
1700/1500
4 Stars
Warrior
FIRE
Effect: If the only monsters in the graveyard are "The 13" monsters, when this card is put into the graveyard, remove it form play. on your next end phase, return it to your hand.

(Just a little reference to how Axel never seems to die in CoM)

The 13 - The Melodius Nocturne
0/0
4 Stars
Spellcaster
WATER
Effect: When this card is normal summoned, special summoned, or set, special summon "Waterforme Tokens" in all avalible monster zones. (500/500) Increase the ATK of this card by 500 for each "Waterforme Token" in play.

The 13 - The Gambler of Fate
1000/1000
4 Stars
Spellcaster
DARK
Effect: Once per turn you may flip five coins. Draw cards equal to the number of heads, and discard equal to the number of tails. You MUST flip five coins if you activate this effect.

The 13 - The Graceful Assassin
700/1300
4 Stars
Warrior
WIND
Effect: Once per turn, during your main phase, you may activate this card's effect. Increase the ATK of this card by 1000 points, and discard two cards. This monster may attack your opponent's life points directly.

The 13 - The Savage Nymph
1600/800
4 Stars
Warrior
LIGHT
Effect: When this card is normal or special summoned, destroy one monster on your opponent's side of the field. If there is "The 13 - The Graceful Assassin" or "The 13 - The Flurry of Dancing Flames" face up on your side of the field, you may destroy one spell or trap card as well.

The 13 - The Key of Destiny
1500/1500
4 Stars
Warrior
LIGHT
Effect: If "The 13 -The Flurry of Dancing Flames" is face up on your side of the field, This monster may not be destroyed as a result of battle.

So, how do you like them? I put some thought into it, and this is what I got. The deck based around these cards is used by the antagonist of my story, Xiikra, just as the original CoM deck is used by his brother, Kiira.

Scarlet Weather November 28th, 2007 7:28 PM

The 13: Nyu, should be XIII to reflect Organization XIII better. Demyx needs a title, by the way.

Superior: No. -1 CA and life point costs to negate attacks is very bad on a two-tribute monster. How about he gets a free attack negation each and every turn? Much more useful, though maybe not enough to warrant two tributes.

Freeshooter: Broken. Why? Because you can recycle spell cards and deal damage for no cost (way to easy to inflict battle damage). I'd say lower the attack to about fifteen hundred or so and get rid of the burn as well as restricting it to when you destroy a monster, or just tack one seven hundred extra points of damage when he battles.

Whirlwind Lancer: Mm-mm. Broken to the max. Why? Because it is special summoned too easily. Dealing battle damage to your opponent is way too easy to do. I'd say make him a tribute monster and require that only a "XIII" monster be sacrificed.

Chilly Academic: Underpowered. Shield crush and say goodbye to your wall, and the discard thing makes no sense.

Silent Hero: Nice, but the wording is wrong. Try "When this monster destroys an opponent's defense-position monster, inflict the difference in this monster's attack points and the opposing monster's defense points to your opponent's life points." I love how Schemer pulls him, as well.

Schemer: Eh, for a situational summoner this pair does all right, though I'd say that this guy needs at least 1900 defense so that Zombie Master doesn't run over him. Zombie hates this monster, as does any deck that likes special summoning. Gladiator Beast doesn't like it when their tag-out gives the opponent a new monster.

Luna Diviner: Card Trooper=Better for quick beatdown hate. I'd say that with the whole berserk thing, shouldn't Saix get to attack multiple targets? 1900 attack point beatstick with the ability to strike twice in a row would fit the role.

Flurry of Dancing Flames: Recurring beatstick that doesn't need to stay in the graveyard? Discard decks will abuse this guy. He's like a hand-jumping Treeborn Frog. I'd say that you should restrict it to destruction by battle.

Demyx: So this guy is basically OTK material. True, Cyber Dragon runs him over on the best of days, but once you get him a clear field you're basically looking at OTK. I'd say to lower the attack of the tokens, or give him fixed attack and have him summon one token per turn or something.

Gambler of Fate: Needs to be some kind of penalty for getting it wrong, and this thing abuses Second Coin Toss. How about you choose whether to keep the first effect and leave it there or continue flipping and risk losing it all? That way you can't abuse him so much. Seriously, either way he's most likely going to self-replace if you get even one heads, and that last effect is way overboard. Change it to a two-card draw, please.

Graceful Assasin: Meh, get rid of the discard requirement. Tell you what, give it 1700 to start with and then let it lower attack to strike directly.

Savage Nymph: Drillroid is already there if we want monster-form shield crush. Let her be mini-zaborg when one of her 13 buddies are face-up (AKA mandatorially destroys any monster when summoned).

Key of Destiny: Crappy monster that turns into buffed marshmallon? No thank you.

Haseo, the Sliver Twilight November 28th, 2007 9:07 PM

Quote:

Originally Posted by ACC-M (Post 3125387)
The 13: Nyu, should be XIII to reflect Organization XIII better. Demyx needs a title, by the way.

Superior: No. -1 CA and life point costs to negate attacks is very bad on a two-tribute monster. How about he gets a free attack negation each and every turn? Much more useful, though maybe not enough to warrant two tributes.

Freeshooter: Broken. Why? Because you can recycle spell cards and deal damage for no cost (way to easy to inflict battle damage). I'd say lower the attack to about fifteen hundred or so and get rid of the burn as well as restricting it to when you destroy a monster, or just tack one seven hundred extra points of damage when he battles.

Whirlwind Lancer: Mm-mm. Broken to the max. Why? Because it is special summoned too easily. Dealing battle damage to your opponent is way too easy to do. I'd say make him a tribute monster and require that only a "XIII" monster be sacrificed.

Chilly Academic: Underpowered. Shield crush and say goodbye to your wall, and the discard thing makes no sense.

Silent Hero: Nice, but the wording is wrong. Try "When this monster destroys an opponent's defense-position monster, inflict the difference in this monster's attack points and the opposing monster's defense points to your opponent's life points." I love how Schemer pulls him, as well.

Schemer: Eh, for a situational summoner this pair does all right, though I'd say that this guy needs at least 1900 defense so that Zombie Master doesn't run over him. Zombie hates this monster, as does any deck that likes special summoning. Gladiator Beast doesn't like it when their tag-out gives the opponent a new monster.

Luna Diviner: Card Trooper=Better for quick beatdown hate. I'd say that with the whole berserk thing, shouldn't Saix get to attack multiple targets? 1900 attack point beatstick with the ability to strike twice in a row would fit the role.

Flurry of Dancing Flames: Recurring beatstick that doesn't need to stay in the graveyard? Discard decks will abuse this guy. He's like a hand-jumping Treeborn Frog. I'd say that you should restrict it to destruction by battle.

Demyx: So this guy is basically OTK material. True, Cyber Dragon runs him over on the best of days, but once you get him a clear field you're basically looking at OTK. I'd say to lower the attack of the tokens, or give him fixed attack and have him summon one token per turn or something.

Gambler of Fate: Needs to be some kind of penalty for getting it wrong, and this thing abuses Second Coin Toss. How about you choose whether to keep the first effect and leave it there or continue flipping and risk losing it all? That way you can't abuse him so much. Seriously, either way he's most likely going to self-replace if you get even one heads, and that last effect is way overboard. Change it to a two-card draw, please.

Graceful Assasin: Meh, get rid of the discard requirement. Tell you what, give it 1700 to start with and then let it lower attack to strike directly.

Savage Nymph: Drillroid is already there if we want monster-form shield crush. Let her be mini-zaborg when one of her 13 buddies are face-up (AKA mandatorially destroys any monster when summoned).

Key of Destiny: Crappy monster that turns into buffed marshmallon? No thank you.

I didn't put too much thought into Superior, so I easily accept the blame for that one.

Xigbar... This guy comes from a trap-based deck. It fit with how I was supposed to run the rest of of the deck. How it counts as battle damage was mainly there to pull Xaldin.

Vexen: Yeah - he's not too good on his own. That's why I have this:
Continuous Trap: Superior Intellect
Effect: "The 13 - The Chilly Academic" cannot be affected by the effects of spell cards.
The discard thing is mainly because with this on the field he becomes near invincible, so it's not very fair.

Lexaeus: I don't like to explain it. I know that isn't the official wording - I just won't write it that way until the card in my fic is revealed.

Zexion: Okay... DEF boost for Zexion. I will now make it 1900.

Saix: I'm not quite sure what you're trying to explain, sorry.

Axel: THe point is, in CoM, Axel is killed in battle several times, yet is still the only one there who makes it to KH2. I'll Rewrite his effect - a clause that only makes him worthwhile in XIII decks.
The 13 - The Flurry of Dancing Flames
1700/1500
4 Stars
Warrior
FIRE
Effect: If the only monsters in the graveyard are "The 13" monsters, when this card is put into the graveyard, remove it form play. on your next end phase, return it to your hand.

Demyx: I've fixed that. I messed up the names for a few of them, but I managed to fix all of them but him before I had to get off. On the card, I see what you mean, however that was partially his point. I'll lower the tokens to 500. 1000 is a bit too much.

Luxord: I have now changed him to:
The 13 - The Gambler of Fate
1000/1000
4 Stars
Spellcaster
DARK
Effect: Once per turn you may flip five coins. Draw cards equal to the number of heads, and discard equal to the number of tails. You MUST flip five coins if you activate this effect.

Marluxia: He was designed to Directly attack for large amounts but be bad on defense. That would eliminate the reason I gave him the direct attacking effect.

Larxene: Changed! New support card added, as well.
Normal Spell: (I can't find the name of Larxene's Slight)
This card may only be activated when "The 13 - The Savage Nymph" is on the field. Inflict damage to your opponent equal to the number of "The 13" monsters in play times 300. Return "The 13 - THe Savage Nymph" to your hand after this card's effect resolves.

Roxas... yeah, I was rushed for time on this one. I'll try again later.

I can't remeber who, but they said Namine wasn't a princess... yeah, seeing as she's half of Kairi, she is.

I thank you all again for the help. However, the Amnesia combo I really want to put in there, so I'm keeping that card. Also, you wouldn't be spamming three Amnesia, just one. I've come up with more cads for the deck, however - ones that don't suck, and once I finish the 40 card deck, I'll put it all up here. Keep bringing me ideas, however. You guys' contribution can only improve it.

ACC-M... On your card, The Decisive Battle, why does it include "Wandering"... it kinda creeped me out, for a reason I'll tell you once I get an answer.

Waker of Chaos November 28th, 2007 11:07 PM

Keyblade Master of Light - Sora
LIGHT Warrior-Type/Gemini
Level 4 ATK 1900 DEF 1200

This card is treated as a Normal Monster while face-up on the field or in the Graveyard. While this card is face-up on the field, you can Normal Summon it to have it be treated as an Effect Monster with these effects. • This card can attack twice during the same Battle Phase. • This card cannot be destroyed by battle while equipped with a "Keyblade" card. • If this card is removed from play by the effect of "Drive Gauge", when it returns to the field, it is treated as an Effect Monster with its effects.

First, I'm not sure if I spelled "Gauge" correctly. I most likely didn't. Second, I figured making him a Gemini Monster would make Sora more balanced.

Keyblade Master of Darkness - Riku
DARK Warrior-Type
Level 6 ATK 2500 DEF 1000

This card cannot be Normal Summoned or Set. This card cannot be Special Summoned except by the effect of "The Road to Dawn". When this card is Summoned or flipped face-up, equip this card with a "Way to the Dawn" or "Soul-Eater" Equip Spell Card from your hand, Deck, Graveyard, or Removed Zone. While this card is equipped with "Way to the Dawn" or "Soul-Eater", neither this card nor the equipped card can be removed from the field, except if this card is destroyed by battle. If this card and "Keyblade Master of Light - Sora" are face-up on the same side of the field, add 1 "Eternal Session" from your Deck, Graveyard, or Removed Zone to your hand.

Yes, he looks kind of overpowered, but note his Summon requirement. Then look at the next card.

The Road to Dawn
Normal Spell
This card cannot be activated unless your opponent controls an "Organization XIII" monster, and you do not control a "Keyblade Master of Light - Sora". Pay 2000 Life Points to Special Summon 1 "Keyblade Master of Darkness - Riku" from your Deck or Removed Zone.

That should balance things out. Now for their team attack Limit.

Eternal Session
Quick-Play Spell
This card can only be activated if it was added to your hand by the effect of "Keyblade Master of Darkness - Riku". When this card is activated, select 1 each of "Last Saber & Dark Cannon", "Master Hearts & XIII Blades", and "All's End" from your Deck, Graveyard, or Removed Zone and add them to your hand. When this card resolves, select 1 monster your opponent controls and destroy it. Your opponent cannot Chain to this card.

Last Saber & Dark Cannon
Quick-Play Spell
Activate only by Chaining this card to your "Eternal Session". Inflict 1000 damage to your opponent for each "Keyblade" Equip Spell Card in your Graveyard and Removed Zone, however that damage is decreased enough if necessary to leave your opponent with 1000 Life Points. Your opponent cannot Chain to this card.

Master Hearts & XIII Blades
Quick-Play Spell
Activate only by Chaining this card to your "Last Saber & Dark Cannon". Destroy all Spell and Trap Cards your opponent controls and remove them from play. Your opponent cannot Chain to this card.

All's End
Quick-Play Spell
Activate only by Chaining this card to your "Master Hearts & XIII Blades". The Chain this card is in resolves forwards instead of backwards. Your opponent takes enough damage to make his or her Life Points equal 1, and all cards in your opponent's hand are removed from play. Cards removed from play by this effect cannot leave the Removed Zone. Your opponent cannot Chain to this card.

Eon-Rider November 29th, 2007 5:02 AM

Fatal Fortress
Monster
*/Rock/Earth
The monster is unaffected by Monster, Spell and Trap effects. This monster cannot be destroyed by battle. All monsters that battle this monster inflict Piercing damage.
ATK/0 DEF/0

Scarlet Weather November 29th, 2007 2:50 PM

Road to Dawn: No. Why? I'll just preserve CA by summoning Riku with a tribute, and what if my opponent isn't playing a XIII deck? Then this is plain useless. *sweatdrop*

Sora: Er.... I have a Sora and a Riku equivalent already created a page ago, along with an entire card set based around them. *sweatrops again* Anyway, the gemini effect here is kind of meh. Sure Sora has high attack, but the inability to be destroyed by battle when equipped with a specific card (which doesn't exist, by the way, since the card I created is "Blade of Heart-Key" not "Keyblade") isn't that great. Attacking twice in one battle phase is already Roxas's thing anyway (go one page back to see what I mean). I've also got a Donald, Goofy, Kairi, and Namine equivalent already.

Riku: Insane brokenness because of his shut-out of effect destruction for only one tribute and his ability to easily pull the Eternal Session cards. At least lower his attack to 2400 so that Monarch can suicide him. I already have an Eternal Session card created.

Eternal Session: This is just beyond broken. Since your opponent can't chain, if you set this up you're looking at OTK. No way is anyone going to recover from getting hit with damage like that, and the combo is way too easy to set up. Reducing their life points to one, destroying a monster on their field, and cutting away their back row all in one card that conveniently searches all four? If you're going to do an auto-win, at least cut the "your opponent cannot chain" bit and remove the ability of Eternal Session to search the other pieces. Nobody could win, ever, against a deck running this unless they managed to outspeed it in record time.

Axel: Still insanely powerful. I suppose, however, the XIII-only requirement and the cost of a normal summon to bring him back make him balanced. I definitely see him as being quite possibly the most useful.

Marluxia: Hmm... this guy is supposed to be an end-game boss. He needs a little more then high direct attack that costs CA. Personally, I'd give him some sort of Auto-Win condition (Like, if he attacks your opponent's life points directly a total of twenty times you win the duel) since he likes reducing points when you fight him in KHII-Final Mix+.

Xigbar: As I stated, Xaldin is broken enough without help.

Sleight of Larxene: Wimpy burn support for a deck that doesn't swarm. 0_o
Then again, the ability to return to the hand and use the summon-destruction effect does have its possibilities...

Superior Intellect: So he needs trap support to save him from spells? Jinzo and Royal Decree laugh at you, since both basically make him a buffed up Marshmallon without burn.

Saix: Card Trooper is a monster run in many competitive decks that tosses three cards from the top of your deck in order to gain 1500 attack and gives you a card when it's destroyed. I'm saying that since Saix likes to go berserk and attack all over the place in-game you should give him the ability to attack multiple times in one turn instead, possibly with an attack increase.

Luxord: Now he's an actual gambler. You should mention that you may only flip each coin once, regardless of card effects. That way you can't abuse this guy with second coin toss.

Lexaeus: You could just copy my wording. XD

Fatal Fortress: No such term as piercing in YGO. Try "When a monster battles this defense-position monster, apply damage calculation as if it was in attack position." So basically tribute fodder that stays around forever but doesn't wall? I suppose that the inability to shield life points makes it a bit more balanced.

Oh, and the reason I included "Wandering" in Decisive Battle's text is that I have a line of monsters based on Final Fantasy characters known as the "Wandering" monsters. AE threw in a bunch of them as well, but I was the originator, I swear. Anyway, if you look back a few pages you'll be able to see them.

Haseo, the Sliver Twilight November 29th, 2007 3:04 PM

Here is my completed deck. I'm going to be printing out the cards I made, and taping them to cards I never use, and dueling against people with this, to test it's limits.

Keybearer x3 - 3
Princess of Heart x2 – 5
Guardian of Heart x2 – 7
Magician of Heart x2 – 9
The King of the Key x1 – 10
The 13 – The Key of Destiny x3 - 13
Blade of Heart – Oblivion Key x1 – 14
Blade of Heart - Oathkeeping Key x1 – 15
Blade of Heart - Ultima Key x1 – 16
Blade of Heart – Pirate’s Key x1 – 17
Blade of Heart – Guardian’s Key x1 – 18
Blade of Heart – Berserk Key x1 – 19
Shadow Corridor x3 – 22
Fateful Premonition x2 – 24
The Castle of the King x1 – 25
Combo Limit – Trinity Limit x1 – 26
Polymerization x2 – 28
Overdrive x3 – 31
Two Crossed x2 – 33
Sleight – Zantetsuken x2 – 35
Sleight – Warpinator x3 – 38
Sleight – Sonic Blade x2 – 40

Keybearer
Monster/Light/Warrior/Effect/4*
ATK 1600/ Def 1500
When this monster is normal summoned or set, look at the top card of your deck. If that card includes the word "Heart" in its name or that is named "The 13 - The Key of Destiny", you may special summon it. A monster summoned in this way cannot attack on the turn it is summoned or be offered as a tribute, and is sent to the graveyard when this monster is destroyed. If the card includes the word “Heart” in it’s name, but is not a monster card, add it to your hand.

Princess of Heart
Monster/Water/Spellcaster/Effect/4*
ATK 1000/Def 1000
If this monster is special summoned, "Keybearer" cannot be removed from the field by card effects. Once per turn, discard one card from your hand in order to place one "Heart Counter" on a monster on your opponent's side of the field. Monsters with "Heart Counters" cannot destroy this monster as a result of battle.

Guardian of Heart
Monster/Earth/Beast-Warrior/Effect/4*
ATK 1500/ Def 1700
When this monster is face-up on the field, you may change the target of one of your opponent's attacks to this monster. If "Keybearer" is on the field while this monster is face-up on the field, increase the attack of "Keybearer" by five hundred points until this monster is removed from the field.

Magician of Heart
Monster/Water/Spellcaster/Effect/4*
ATK 1700/Def 1500
If "Keybearer" is face-up on the field when this monster inflicts battle damage to your opponent's life points, you may place one spell card from your graveyard on the top of your deck.

The King of the Key
Monster/Light/Divine-Beast/Effect/6*
Atk 2400/Def 2000
This monster's name is treated as "Keybearer" for the purpose of determining card effects. While this monster is face-up on the field, increase the attack of all monsters with "Heart" in their names by five hundred points.

The 13 – The Key of Destiny
800/750
This monster may have two “Blade of Heart” cards equipped to it at the same time.

(I made it so you can only equip one to both Mickey and Sora - it didn't seem right otherwise.)

Blade of Heart - Oblivion Key
Equip Spell
This card may only be equipped to "Keybearer", or "The 13 - The Key of Destiny. Increase the equipped monster's attack by eight hundred points. If the equipped monster would be destroyed as a result of battle, destroy this card instead. When the equipped monster destroys a monster as a result of battle, inflict 800 points of damage to your opponent’s life points.

Blade of Heart - Oathkeeping Key
Equip Spell
Effect: This card may only be equipped to "Keybearer", or "The 13 - The Key of Destiny. Increase the equipped monster's attack by seven hundred points. If the equipped monster would be destroyed as a result of battle, destroy this card instead. When this card is destroyed by its own ability, destroy one monster on your opponent’s side of the field.

Blade of Heart - Ultima Key
Equip Spell
Effect: This card may only be equipped to "Keybearer". Increase the equipped monster's attack by one thousand points. If the equipped monster would be destroyed as a result of battle, destroy this card instead. Any monster that battles with the equipped monster is destroyed after damage calculation.

Blade of Heart – Pirate’s Key
Equip Spell
Effect: This card may only be equipped to "Keybearer", or "The 13 - The Key of Destiny. Increase the equipped monster's attack by four hundred points. If the equipped monster would be destroyed as a result of battle, destroy this card instead. When the equipped monster inflicts battle damage to your opponent, add one “Blade of Heart” from your graveyard to your hand.

Blade of Heart – Guardian’s Key
Equip Spell
Effect: This card may only be equipped to "Keybearer", or "The 13 - The Key of Destiny.” Increase the equipped monster's defense by six hundred points. If the equipped monster would be destroyed as a result of battle, destroy this card instead. Once per turn you may redirect an attack on one of your monsters to the equipped card.

Blade of Heart – Berserk Key
Equip Spell
Effect: This card may only be equipped to "Keybearer", or "The 13 - The Key of Destiny. Increase the equipped monster's attack by four hundred points. If the equipped monster would be destroyed as a result of battle, destroy this card instead. The equipped monster must attack all monsters on your opponent’s side of the field once per turn, and its ATK increases by 500 during damage calculation only.

Shadow Corridor
Counter Trap
When your opponent declares an attack on a “The 13”, "Key" or "Heart" monster you control, negate the attack and discard one card from the opponent's hand to the graveyard.

Fateful Premonition
Normal Spell
Select one card from your Deck and remove it from play face-down. At any time during the duel, when your opponent summons or activates the effect of a card, you may reveal the card removed from play by this card's effect. If the card your opponent played has the same name as the card you revealed, negate the summoning or activation of that card and remove it from play, then add the card you revealed to your hand.

Castle of the King
Field Spell
Increase the attack of all "Heart" and "Key" monsters by three hundred points. Once per turn, by paying eight hundred life points you may place one "Heart" or "Key" monster from your deck or graveyard on top of your deck.

Combo Limit - Trinity Limit
Normal Spell
This card is treated as a "Limit Break" Spell Card. Pay half your life points and select one face-up "Keybearer", one face-up "Guardian of Heart" and one face-up "Magician of Heart" on your Field. Until the end of the turn this effect is activated, the ATK of each of the selected monsters becomes half the combined original ATK of the selected monsters and each of the selected monsters can attack three times in the same Battle Phase. Whenever one of the selected monsters inflicts Battle Damage this turn, that Battle Damage becomes 500. If the selected monsters are the only monsters on your Field, you do not need to pay any Life Points to activate this card. You may only activate one "Limit Break" Spell Card each turn.

Overdrive
Normal Spell
Select one monster in your fusion deck with “Drive Form” in its name. Shuffle all cards listed in its fusion text from your field into your deck, and special summon the selected monster. This does not count as a fusion summon.

Two Crossed
Equip Spell
This card may only be equipped to a "Key" monster. When this card is sent to the graveyard as a result of the equipped monster being destroyed, special summon one "Keybearer" and one "The 13 - The Key of Destiny" from your hand or deck.

Sleight – Zantetsuken
Counter Trap
Effect: Activate only if there is a face-up “Keybearer” on your side of the field. Discard one card from your hand to negate the activation/effect/summoning of a card, and destroy it. No cards sharing the same name as the destroyed card may be played.

Sleight – Warpinator
Normal Trap
Effect: Activate only if there is a face-up “Keybearer” on your side of the field. Remove one opponent’s attacking monster from play.

Sleight – Sonic Blade
Continuous Trap
Effect: All face-up “Keybearer” may attack twice per battle phase with the card’s original ATK being applied for damage calculation.

As you can see, I made soem new cards, used some of your made ones, an modifed others a bit to fit the deck's purposes. Thank you all for your help.

Scarlet Weather November 29th, 2007 5:13 PM

Overdrive: Not good, because most fusion monsters say they are only summoned through fusion summoning. Why not say that it counts as a fusion summon, since that doesn't take up your normal summon anyway?

Princess of Heart: Oh come on, at least use my improved version. *sweatdrops*

The XIII-Key of Destiny: No, and why? Two equips is just poor, since nothing in the keyblades's effects makes them unequippable two at a time, so he's technically just a crappy vanilla without vanilla support right now. Try using the two attack version, please?

Guardian's Key: Fair enough.

Berserk Key: Wow, I like this one. Which keyblade are we converting here?

Pirate's Key: Serves to recall keys from the graveyard, eh?

Oblivion: Moderate burn damage and attack boost.

Oathkeeping: Valuable because of its "paralysis" style effect, and that it can pay for itself.

Ultima Key: Obviously the strongest of the keys.

Magician of Heart: Change the text to say when it destroys a monster, not when you inflict damage, since AE pointed out that this was a bit too powerful otherwise.

Two Crossed: Technically, this should be a blade of heart since it's based on a Final Mix only keyblade.

Sonic Blade: Why not ditch this and give XIII twin battle phase attacks instead of pouring way too much support into one monster?

Zantetsuken: Solemn judgement does this better, I'd say, since it isn't monster specific and you don't lose CA. I'd say that you should change it around a bit.

Overall, too many supports and not enough monsters. I'd say to dump Guardian's Key and Oblivion in favor of two copies of Iron Blacksmith-Kotetsu (flip monster that adds an equip spell to the hand) as well as two Sonic Drive and one Zantetsuken in favor of three Twilight Warrior of Heart (or Twilight Keybearer, as you could call it). Fateful Premonition can be cut to one in favor of adding a recruiter like Warrior Lars (who is insanely useful in this deck because of his synergy with Keybearer). Finally, an overdrive can be replaced with a copy of mirror force or torrential tribute. Fusion in general is nutty, and Sora would work better with Neos-Style contact fusion anyway, so maybe you should consider dropping fusion support in favor of a few more general support cards like Mirror Force, etc.

Edit: Actually, ditch both copies of Fateful P., since it's meant to be played in decks using "staples" (like smashing ground, etc.) Your deck has no staples for obvious reasons, so it won't work.

Eon-Rider November 29th, 2007 9:28 PM

Quote:

Originally Posted by ACC-M (Post 3127191)
Fatal Fortress: No such term as piercing in YGO. Try "When a monster battles this defense-position monster, apply damage calculation as if it was in attack position." So basically tribute fodder that stays around forever but doesn't wall? I suppose that the inability to shield life points makes it a bit more balanced.

Try checking Cyberdark Horn's effect. ;)

When this card is Normal Summoned, select 1 Level 3 or lower Dragon-Type monster in your Graveyard and equip it to this card. This card gains ATK equal to the equipped card's ATK. This card inflicts Piercing damage. If this card would be destroyed by battle, the equipped monster is destroyed instead.

Scarlet Weather November 29th, 2007 9:40 PM

I stand corrected. I blame Alter Ego for telling me that. XD

Frostweaver November 29th, 2007 11:52 PM

Wrong source you're quoting to ever say that Cyberdark Horn ever uses the word "piercing."

Cyberdark Horn CDIP-EN001 Super Rare from 1st Ed. Cyberdark Impact

When this card is Normal Summoned, select 1 Level 3 or lower Dragon-Type monster in your Graveyard and equip it to this card. This card gains ATK equal to the equipped card's ATK. During battle between this attacking card and a Defense Position monster whose DEF is lower than the ATK of this card, inflict the difference as Battle Damage to your opponent. If this card would be destroyed by battle, the equipped monster is destroyed instead.

Eon-Rider November 30th, 2007 12:07 AM

I don't understand. There are no erratas on Cyberdark Horn or Elemental Hero Plasma Vice and they both have 2 versions that either use Piercing or the longer text. I have a Cyberdark Horn containing the Piercing text but a Plasma Vice that has the longer text. However, Netrep has Piercing for both of them.

Frostweaver November 30th, 2007 12:28 AM

Will be very glad to even see a card scan of YGO using the word "piercing" u_u seriously, I really am doubting you a lot on having a physical card that says "piercing."

From YGO wikia wiki:

"Piercing" is the UDEized word for Trample (as used in MTG, etc). Pierce is the word used in the Yu-Gi-Oh! Video Games, and the effect is characterised by the following text in the card lore:

During battle between this attacking card and a Defense Position monster whose DEF is lower than the ATK of this card, inflict the difference as Battle Damage to your opponent.


And we know that in the YGO Video games, they named Elemental Hero Elixir some really bizarre name that is incorrect... don't forget the Dark Spellian and Dark Spellian Girl in the video games too when it comes to wording.

Alter Ego November 30th, 2007 2:22 AM

Indeed, piercing has never been an YGO term, though some peoples use that in discussion because it's shorter to type. Seriously, ACC, check the freakin' card before pointing fingers at me for making you do the effects right. :< And Elixir = Erikshieler, at least in Spirit Caller. They've got some really funky effect wordings there too (Like on Damage Polyrizer, x.O).

And yeah, Fateful Premonition cries for a staple-heavy deck to really shine. Game turning cards like Heavy Storm are choice picks. Light and Darkness Dragon and monarchs (particularly Raiza, since that thing is everywhere) could also turn out very nice, but since you don't have any of those it would just be removing a card of yours (beyond the reach of all recursion, might I add) for the rest of the game. Premonition isn't something you can just splash into a deck. D=

Anyways, so many cards...

The Decisive Battle: I...don't think I'd use this, to be honest. I mean, you're not really gaining anything in terms of damage (heck, since it runs by originals you may actually lose out on that point) and putting everything on a single attacker is just crying for a Sakuretsu, or worse...Magic Cylinder. x.x I think I'll pass.

The Superior: Erm, yeah...way too lackluster. There are so many cooler two-tributes out there that a measly burn and attack negation just isn't worth the bother of summoning this.

The Freeshooter: free spell cycling and burn on a beatstick-size monster? Uh-huh...for the greater balance I'd say cut the Atk to 1700 and have it remove the spell card from play instead. That should make it balanced.

The Whirlwhind Lancer: you misspelled "whirlwind" there. No idea what you're trying to say with that second effect, but if I understood the first one correctly then this is just too cheap. Like ACC said: dealing battle damage is a piece of cake and certainly not a worthy requirement for summoning a 2200-atk beatstick. This doesn't really fit Xaldin's battles style with all those spears either. o.O

The Chilly Academic: It's like a slightly weaker Gellen Duo without the vulnerability to damage. Ehh...I dunno', this would most likely end up limited because its only weak wouldn't usually see light. Searchable invulnerables are a major pain in the butt.

The Silent Hero: Meh, lousy thing to draw into, but it makes the schemer tick.

The Cloaked Schemer: Wow...this really makes messy-hair and Lexaeus look like the bestest of bum-chums. Pretty darn annoying since there's really no way to avoid facing the beatstick if there's already one of them in the graveyard. Meh, I'd almost say too strong. Again, this doesn't really fit with his sneaky battle strategies.

The Luna Diviner: Never knew he was into gambling. Dunno', this doesn't really capture his whole charge up and rush approach.

The Flurry of Dancing Flames: You so need to reword. >.< "If this card is sent to your Graveyard and the only monster cards in your Graveyard are "The 13" monsters, remove this card from play, then add it to your Hand during your next End Phase". Well, self-recursion is always nice, but good luck turning these into a functioning deck. x.x

The Melodius Nocturne: "When this card is summoned successfully (Including Flip Summon) Special Summon as many Waterform Tokens (Aqua Type/Water Attribute/1 Star/500 Atk/500 Def) to your Field as possible. For each Waterform Token on your Field, increase the Atk of this card by 500.". Bleah, sucky, even when giving the maximal amount of space to these tokens you only get a worse edition of Gene-Warped Warwolf. I'd say increase the boost to 700 per token and add a little clause of protection "While there is a Waterform Token(s) on your Field, this card can not be selected as the target of an attack or card effect.".

The Gambler of Fate: Umm...pretty crazy. Even if you end up discarding more than you draw, you still get a lot of deck cycling done with this. How about something like this? "Whenever this card attacks is attacked, select a card at random from your Hand. Then, your opponent must guess the type of the card you selected (Spell, Trap, or Monster). If your opponent guesses wrong, no battle occurs. Instead, inflict damage to your opponent equal to half the original Atk of the monster this card would have battled with." Sort of a different kind of gamble, but it brings in his whole card game shtick.

The Graceful Assassin: -2 for a crappy direct attack on a monster that's otherwise completely crappy? No, just no. How about giving Marluxia something that actually makes him useful?

The Savage Nymph: Not really seeing Larx in this, nor the point of dragging Axel into the effect. It's a bit too strong given that it can take out two cards immediately too.

Keyblade Master of Light - Sora: There's nothing balanced about this. Double-attacking 1900 is already too good for gemini, and let's not even get me started about all those other effects. Just...balance, for the love all that is sweet and sugary, balance.

Keyblade Master of Darkness - Riku + Road to Dawn: Yeah, worthless. No way am I wasting deckspace and that many life points for something like this, especially when it's so dependent on what my opponent is doing. xP

Eternal Session: I think I'll stick to ACC's edition. Nothing linked to the aforementioned card can ever be useful.

Last Saber & Dark Cannon: see above.

Master Hearts & XIII Blades: again, see above.

All's End: you know what I would have said here, right?

The Key of Destiny: I prefer Ben Kei, thank you very much. Oh, and since there's no restriction on the key equips his whole ability is pointless anyway.

Overdrive: there are no drive form monsters, so this really doesn't do anything whatsoever.

Blade of Heart cards: Just...too weak, all of them. I mean, even United We Stand is rarely used, and that's way better than any one of these.

Sleight – Zantetsuken: Whoa, that's pretty harsh negation. It's like a far wider-scope Cursed Seal of the Forbidden Spell. I say make it demand a card of the same type as the one your negating. Also, on the wording for that last bit "For the remainder of the Duel, neither player may Set, Summon or activate the effects of a card(s) with the same name as the card destroyed by this effect."

Sleight – Warpinator: Weird wording. Just say, "This card can only be activated when your opponent declares an attack while "Keybearer" is face-up on your Field. Remove the attacking monster from play."

Sleight – Sonic Blade: I duno'. I'd say make it something like "If "Keybearer" destroys your opponent's monster by Battle during your Battle Phase, you may discard one card from your Hand. If you do, "Keybearer" can attack once again in a row." in lieu with the spamming of attacks in that sleight. Still not very trap-like, though, and I've never been too fond of monster specifics.

And...there's just way too many monster-specific cards in that deck. x.x To start with, you seriously need to cut down on those keyblades. Sure, if you make one that's actually useful then you can run a copy or two, but with all of those in your deck you'd have to topdeck like freakin' Atemu to pull through. Drop premonition (too staple dependent for this), poly and overdrive (seriously, we don't need any measly attempts at fusion to compound the already crazy amount of bad draws here). Also, get rid of corridor and ditch that Roxas for ACC's actually workable version. Similarly, get the improved version of ACC's princess instead of the original and throw in another copy of Castle of the King. Guardian and Magician up to three since they're the few readily usable monsters in this set and work with Sora's swarm effect. Also, work in Call of the Haunted, Mirror Force, Premature Burial, Heavy Storm, Mystical Space Typhoon, and Torrential Tribute, along with one copy each of Smashing Ground and Fissure. All of them are high-utility cards, and this deck really, REALLY needs more of those to balance the nominess. Also, drop all three copies of Warpinator since it's too specific to serve your protection needs here. You may also want to ditch Sonic Blade: again, it's too specific to be of proper use. Also, add in three copies Twilight Warrior of the Heart (seriously, that one should be a no-brainer) and possibly a copy of Witch of Memory to bump up your monster card count, since it's way too low right now. Maybe even a second copy of the king. There's nothing wrong with playing thematic, but let's try to make it semi-functional at least.


Fatal Fortress: So it's basically a Rock type cloudian with built-in effect protection. This + Spirit Barrier, obviously, but that's pretty much where the tricks end. Anyways, that piercing thing is a load of bull; just go with "This Attack Position card can not be destroyed by battle blah blah blah". It basically amounts to the same thing.


Anyways, that aside...I think it's time for some metagame hate:

Decompose
Continuous Spell

As often as you like, during your Standby Phase, by paying 200 Life Points you may select one Monster Card that has been in the Graveyard for two turns or more and remove it from play.


And now that that is over and done with:

Kaiser Wing
Dragon/Effect
5 Star/Light
2300 Atk / 700 Def

You may Normal Summon this card without Tribute OR treat the Normal Summon of this card as a Special Summon. If you do, your opponent may select one Monster Card from his/her Hand and Special Summon it.

Dragon's Roar
Continuous Trap

Whenever you successfully summon a Dragon Type monster (Including Flip Summon) all monsters on the Field (excluding Dragon Type monsters) of a lower level than the monster you summoned are switched into Defense Position.

Frostweaver November 30th, 2007 2:49 AM

(they win. Piercing is now the official wording together with the long text. Of course, being lazy is always the winner. Refer to the other thread.)

Waker of Chaos November 30th, 2007 6:16 AM

Quote:

Originally Posted by ACC-M (Post 3127191)
Road to Dawn: No. Why? I'll just preserve CA by summoning Riku with a tribute, and what if my opponent isn't playing a XIII deck? Then this is plain useless. *sweatdrop*

You overlooked the first two sentences on "Keyblade Master of Darkness - Riku".

Sora: Er.... I have a Sora and a Riku equivalent already created a page ago, along with an entire card set based around them. *sweatrops again* Anyway, the gemini effect here is kind of meh. Sure Sora has high attack, but the inability to be destroyed by battle when equipped with a specific card (which doesn't exist, by the way, since the card I created is "Blade of Heart-Key" not "Keyblade") isn't that great. Attacking twice in one battle phase is already Roxas's thing anyway (go one page back to see what I mean). I've also got a Donald, Goofy, Kairi, and Namine equivalent already.

I don't care. This is only part of my Kingdom Hearts set, so it doesn't matter to me if you made some already or not.

Riku: Insane brokenness because of his shut-out of effect destruction for only one tribute and his ability to easily pull the Eternal Session cards. At least lower his attack to 2400 so that Monarch can suicide him. I already have an Eternal Session card created.

Again, read his entire effect.

Eternal Session: This is just beyond broken. Since your opponent can't chain, if you set this up you're looking at OTK. No way is anyone going to recover from getting hit with damage like that, and the combo is way too easy to set up. Reducing their life points to one, destroying a monster on their field, and cutting away their back row all in one card that conveniently searches all four? If you're going to do an auto-win, at least cut the "your opponent cannot chain" bit and remove the ability of Eternal Session to search the other pieces. Nobody could win, ever, against a deck running this unless they managed to outspeed it in record time.

That's what it's meant to be. You could always use "Cursed Seal of the Forbidden Spell", "Magic Jammer", or "Imperial Order" (Traditional Format only) on my "The Road to Dawn", you know. Besides, I specialize in "overpowered" cards anyway.

My reasoning's in your quote in bold.

Haseo, the Sliver Twilight November 30th, 2007 6:38 PM

Overdrive: Not good, because most fusion monsters say they are only summoned through fusion summoning. Why not say that it counts as a fusion summon, since that doesn't take up your normal summon anyway?

The Sora Drive forms that I'm making to go with this card do not say so.

Princess of Heart: Oh come on, at least use my improved version. *sweatdrops*

I like this one better. I'll use the improved one if I find it lacking in an actual duel.

The XIII-Key of Destiny: No, and why? Two equips is just poor, since nothing in the keyblades's effects makes them unequippable two at a time, so he's technically just a crappy vanilla without vanilla support right now. Try using the two attack version, please?

Everyone brought this up. It is not listed on the cards because it is a generic rule for my set. Cards do not say "If you noraml summon this card, you cannot normal summon another monser in the same turn" do they? No, they do not.

Guardian's Key: Fair enough.

Thanks for not criticizing. I kinda took a leap of faith here on whether people would like it or hate it.

Berserk Key: Wow, I like this one. Which keyblade are we converting here?

One of my favorites too. It's KHII Fenrir, which you obtain from defeating Sephiroth. Roxas was designed to be the ultimate user of this equip, adding another Keyblade's power to it.

Pirate's Key: Serves to recall keys from the graveyard, eh?

Yup. I needed a way to do so, and it was the logical choice.

Oblivion: Moderate burn damage and attack boost.

Right on it.

Oathkeeping: Valuable because of its "paralysis" style effect, and that it can pay for itself.

Revenge, pure and simple. You take out the Oathkeeper, it takes out you. I almost put this ability on Obivion, but I like it the way it is.

Ultima Key: Obviously the strongest of the keys.

Just as it should be.

Magician of Heart: Change the text to say when it destroys a monster, not when you inflict damage, since AE pointed out that this was a bit too powerful otherwise.

Got it.

Two Crossed: Technically, this should be a blade of heart since it's based on a Final Mix only keyblade.

Okay.

Sonic Blade: Why not ditch this and give XIII twin battle phase attacks instead of pouring way too much support into one monster?

I forgot to put Roxas on there! He's supposed to be affected by it too, but I only now realized that I accidently left him off. Your wanting Roxas to attack twice was even the reason I made that card.

Zantetsuken: Solemn judgement does this better, I'd say, since it isn't monster specific and you don't lose CA. I'd say that you should change it around a bit.

I think it's just fine. I'd rather lose cards than LP. - Especially against those I play against.





The Superior: Erm, yeah...way too lackluster. There are so many cooler two-tributes out there that a measly burn and attack negation just isn't worth the bother of summoning this.

I've already changed this.You'll see what to once I finish his deck.

The Freeshooter: free spell cycling and burn on a beatstick-size monster? Uh-huh...for the greater balance I'd say cut the Atk to 1700 and have it remove the spell card from play instead. That should make it balanced.

Yeah... but this is for a deck made to be used by one of my main villains, so being slightly overpowered is good.

The Whirlwhind Lancer: you misspelled "whirlwind" there. No idea what you're trying to say with that second effect, but if I understood the first one correctly then this is just too cheap. Like ACC said: dealing battle damage is a piece of cake and certainly not a worthy requirement for summoning a 2200-atk beatstick. This doesn't really fit Xaldin's battles style with all those spears either. o.O

yeah... Xaldin has already been changed.

The Chilly Academic: It's like a slightly weaker Gellen Duo without the vulnerability to damage. Ehh...I dunno', this would most likely end up limited because its only weak wouldn't usually see light. Searchable invulnerables are a major pain in the butt.

Every "The 13" is searchable in it's own deck, and that's what it's made for.

The Silent Hero: Meh, lousy thing to draw into, but it makes the schemer tick.

That's why I have ways around it in it's "The 13" deck.

The Cloaked Schemer: Wow...this really makes messy-hair and Lexaeus look like the bestest of bum-chums. Pretty darn annoying since there's really no way to avoid facing the beatstick if there's already one of them in the graveyard. Meh, I'd almost say too strong. Again, this doesn't really fit with his sneaky battle strategies.

They're partners, like Kisame and Itachi. I'd say that Itachi is Zexion and Kisame is Lexaeus. But on topic - This is one Zexion. There is a second in the deck - beware that one. He has the most effects out of any of the 13. Almost too strong - good! The main villains need strong decks.

The Luna Diviner: Never knew he was into gambling. Dunno', this doesn't really capture his whole charge up and rush approach.

Yeah - originally it was to portray whether he was in berserk mode for that battle or not, but I don't really like it anymore either. I'm currently correcting that.

The Flurry of Dancing Flames: You so need to reword. >.< "If this card is sent to your Graveyard and the only monster cards in your Graveyard are "The 13" monsters, remove this card from play, then add it to your Hand during your next End Phase". Well, self-recursion is always nice, but good luck turning these into a functioning deck. x.x

I almost already have.

The Melodius Nocturne: "When this card is summoned successfully (Including Flip Summon) Special Summon as many Waterform Tokens (Aqua Type/Water Attribute/1 Star/500 Atk/500 Def) to your Field as possible. For each Waterform Token on your Field, increase the Atk of this card by 500.". Bleah, sucky, even when giving the maximal amount of space to these tokens you only get a worse edition of Gene-Warped Warwolf. I'd say increase the boost to 700 per token and add a little clause of protection "While there is a Waterform Token(s) on your Field, this card can not be selected as the target of an attack or card effect.".

Originally is was 1000 per token, but that was almost OTK. I'll add not being targeted - espcially because you can't do so in the game either. HE has a support card, though. You'll see it soon enough, and It'll appear in the first chapter Xiikra does.

The Gambler of Fate: Umm...pretty crazy. Even if you end up discarding more than you draw, you still get a lot of deck cycling done with this. How about something like this? "Whenever this card attacks is attacked, select a card at random from your Hand. Then, your opponent must guess the type of the card you selected (Spell, Trap, or Monster). If your opponent guesses wrong, no battle occurs. Instead, inflict damage to your opponent equal to half the original Atk of the monster this card would have battled with." Sort of a different kind of gamble, but it brings in his whole card game shtick.

That's awesome. I totally love that effect. Thanks a lot!

The Graceful Assassin: -2 for a crappy direct attack on a monster that's otherwise completely crappy? No, just no. How about giving Marluxia something that actually makes him useful?

It's a pretty good direct attack, sniping the opponent for 1700 per turn, that's five turn kill with just that damage. Plus, each one of the 13 has a support card. Marluxia was also designed with 4000LP battle in mind.

The Savage Nymph: Not really seeing Larx in this, nor the point of dragging Axel into the effect. It's a bit too strong given that it can take out two cards immediately too.

Hmm... got a better effect, then? I'm always looking to improve. Axel's in there because Him, Marluxia, and Larxene were partners topside.

The Key of Destiny: I prefer Ben Kei, thank you very much. Oh, and since there's no restriction on the key equips his whole ability is pointless anyway.

Already answered this.

Overdrive: there are no drive form monsters, so this really doesn't do anything whatsoever.

It does. When was there a law you can't add fusion monster to a deck after the concept has been thought of? Cause I've been breaking it everytime I obtain a new E-hero fusion then.

Blade of Heart cards: Just...too weak, all of them. I mean, even United We Stand is rarely used, and that's way better than any one of these.

United we stand is great. If you're looking to have a deck full of those, don't comment on this one, though. This is based off of a game. There is no United we stan in Kingdom hearts, and if there was, it wouldn't matter much anyway. Keyblades are the signature of KH, so they will be used.

Sleight – Zantetsuken: Whoa, that's pretty harsh negation. It's like a far wider-scope Cursed Seal of the Forbidden Spell. I say make it demand a card of the same type as the one your negating. Also, on the wording for that last bit "For the remainder of the Duel, neither player may Set, Summon or activate the effects of a card(s) with the same name as the card destroyed by this effect."

Thanks for the wording. I wouldn't want some of my friends to take advantage of any loopholes I might accidently create. As for harsh negation - Have you played CoM? That's what it does in there, too.

Sleight – Warpinator: Weird wording. Just say, "This card can only be activated when your opponent declares an attack while "Keybearer" is face-up on your Field. Remove the attacking monster from play."

I've seen similar wording on a different card somewher, and that's what I based the wording off of. I'll change it if you're really so opposed to it, though.

Sleight – Sonic Blade: I duno'. I'd say make it something like "If "Keybearer" destroys your opponent's monster by Battle during your Battle Phase, you may discard one card from your Hand. If you do, "Keybearer" can attack once again in a row." in lieu with the spamming of attacks in that sleight. Still not very trap-like, though, and I've never been too fond of monster specifics.

Eh, Roxas is suppoed to be on there too, and it also includes King Mickey, so that's fine with me. Most of my monsters can use it.
However, I will probably do the destroy to attack again so there's no double direct attacks with it.

Sure, if you make one that's actually useful then you can run a copy or two, but with all of those in your deck you'd have to topdeck like freakin' Atemu to pull through.

You're saying this to a guy who had Pot of Greed or Cyber jar, and many times both, in their starting hand of an 80 card deck. Plus, this is mainly to be used by a main character of a fic, thus topdecking incessantly is okay. I'll probably add some drawing cards in there, though.

Similarly, get the improved version of ACC's princess instead of the original and throw in another copy of Castle of the King. Guardian and Magician up to three since they're the few readily usable monsters in this set and work with Sora's swarm effect.

Yeah - if the original pricess doesn't work for me, I'll use the better one, but I don't want to start with that - people will say I'm cheap, until I can prove that there are weak madeup cards. I'll probably put in another D&G instead of the polymers.

Also, add in three copies Twilight Warrior of the Heart (seriously, that one should be a no-brainer)

I got laughed at when my friend told me I forgot Riku. HOW DO YOU FORGET RIKU!!! THAT WAS SO STUPID!!!

Actually, ditch both copies of Fateful P., since it's meant to be played in decks using "staples" (like smashing ground, etc.) Your deck has no staples for obvious reasons, so it won't work.

I put that in there because I plan to thow in sakeretsu for that purpose alone, but then I realized that Zantetsuken already helps me with that, and I forgot to take tham out. The will become rikus, and riku will be added to the Keyblade cards.

EDIT: Also, did anyone notice that I made Mickey a God Card? I'm seriously surprised no one mentioned that.


All times are GMT -8. The time now is 11:44 AM.


Like our Facebook Page Follow us on Twitter © 2002 - 2018 The PokéCommunity™, pokecommunity.com.
Pokémon characters and images belong to The Pokémon Company International and Nintendo. This website is in no way affiliated with or endorsed by Nintendo, Creatures, GAMEFREAK, The Pokémon Company or The Pokémon Company International. We just love Pokémon.
All forum styles, their images (unless noted otherwise) and site designs are © 2002 - 2016 The PokéCommunity / PokéCommunity.com.
PokéCommunity™ is a trademark of The PokéCommunity. All rights reserved. Sponsor advertisements do not imply our endorsement of that product or service. User generated content remains the property of its creator.

Acknowledgements
Use of PokéCommunity Assets
vB Optimise by DragonByte Technologies Ltd © 2023.